ID: 1036310124

View in Genome Browser
Species Human (GRCh38)
Location 8:7679648-7679670
Sequence ACGTTGGCCCCTGAATCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036310124_1036310133 15 Left 1036310124 8:7679648-7679670 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036310133 8:7679686-7679708 AGCTCACAGGGACAGCGCCCCGG No data
1036310124_1036310134 16 Left 1036310124 8:7679648-7679670 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036310134 8:7679687-7679709 GCTCACAGGGACAGCGCCCCGGG No data
1036310124_1036310127 -9 Left 1036310124 8:7679648-7679670 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036310127 8:7679662-7679684 GGCCAACGTTTGCAGGACACCGG No data
1036310124_1036310130 2 Left 1036310124 8:7679648-7679670 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036310130 8:7679673-7679695 GCAGGACACCGGGAGCTCACAGG No data
1036310124_1036310128 -8 Left 1036310124 8:7679648-7679670 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036310128 8:7679663-7679685 GCCAACGTTTGCAGGACACCGGG No data
1036310124_1036310136 25 Left 1036310124 8:7679648-7679670 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036310136 8:7679696-7679718 GACAGCGCCCCGGGGATGCAAGG No data
1036310124_1036310131 3 Left 1036310124 8:7679648-7679670 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036310131 8:7679674-7679696 CAGGACACCGGGAGCTCACAGGG No data
1036310124_1036310135 17 Left 1036310124 8:7679648-7679670 CCCGGTGATTCAGGGGCCAACGT No data
Right 1036310135 8:7679688-7679710 CTCACAGGGACAGCGCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036310124 Original CRISPR ACGTTGGCCCCTGAATCACC GGG (reversed) Intergenic
No off target data available for this crispr