ID: 1036311115

View in Genome Browser
Species Human (GRCh38)
Location 8:7685115-7685137
Sequence TAGCATGACCTGAAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036311115_1036311123 14 Left 1036311115 8:7685115-7685137 CCATCATCCTTCAGGTCATGCTA No data
Right 1036311123 8:7685152-7685174 TGTGGACCAAAAAATTCAGCGGG No data
1036311115_1036311117 -4 Left 1036311115 8:7685115-7685137 CCATCATCCTTCAGGTCATGCTA No data
Right 1036311117 8:7685134-7685156 GCTATTCCCATTTCCCTCTGTGG No data
1036311115_1036311124 15 Left 1036311115 8:7685115-7685137 CCATCATCCTTCAGGTCATGCTA No data
Right 1036311124 8:7685153-7685175 GTGGACCAAAAAATTCAGCGGGG No data
1036311115_1036311122 13 Left 1036311115 8:7685115-7685137 CCATCATCCTTCAGGTCATGCTA No data
Right 1036311122 8:7685151-7685173 CTGTGGACCAAAAAATTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036311115 Original CRISPR TAGCATGACCTGAAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr