ID: 1036311346

View in Genome Browser
Species Human (GRCh38)
Location 8:7686458-7686480
Sequence CCCGCCGCTGCCGGGCACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036311346_1036311351 2 Left 1036311346 8:7686458-7686480 CCTTCGTGCCCGGCAGCGGCGGG No data
Right 1036311351 8:7686483-7686505 CTCCCTGTCCTCGCAGTCCTCGG No data
1036311346_1036311352 3 Left 1036311346 8:7686458-7686480 CCTTCGTGCCCGGCAGCGGCGGG No data
Right 1036311352 8:7686484-7686506 TCCCTGTCCTCGCAGTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036311346 Original CRISPR CCCGCCGCTGCCGGGCACGA AGG (reversed) Intergenic