ID: 1036314083

View in Genome Browser
Species Human (GRCh38)
Location 8:7707356-7707378
Sequence AAGGGCCTATTGAATTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036314083_1036314090 9 Left 1036314083 8:7707356-7707378 CCCCCAGAATTCAATAGGCCCTT No data
Right 1036314090 8:7707388-7707410 TCACACTCCATGCACTTGAAGGG No data
1036314083_1036314089 8 Left 1036314083 8:7707356-7707378 CCCCCAGAATTCAATAGGCCCTT No data
Right 1036314089 8:7707387-7707409 ATCACACTCCATGCACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036314083 Original CRISPR AAGGGCCTATTGAATTCTGG GGG (reversed) Intergenic
No off target data available for this crispr