ID: 1036314242

View in Genome Browser
Species Human (GRCh38)
Location 8:7708379-7708401
Sequence CCGACAGCAGGTACGTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036314242_1036314245 -1 Left 1036314242 8:7708379-7708401 CCAAGTAACGTACCTGCTGTCGG No data
Right 1036314245 8:7708401-7708423 GCAGATCTGAGCTTTCTTCTTGG 0: 69
1: 55
2: 26
3: 35
4: 431
1036314242_1036314247 25 Left 1036314242 8:7708379-7708401 CCAAGTAACGTACCTGCTGTCGG No data
Right 1036314247 8:7708427-7708449 CCTTCTACCCACAGTCCTCCAGG No data
1036314242_1036314248 30 Left 1036314242 8:7708379-7708401 CCAAGTAACGTACCTGCTGTCGG No data
Right 1036314248 8:7708432-7708454 TACCCACAGTCCTCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036314242 Original CRISPR CCGACAGCAGGTACGTTACT TGG (reversed) Intergenic
No off target data available for this crispr