ID: 1036314248

View in Genome Browser
Species Human (GRCh38)
Location 8:7708432-7708454
Sequence TACCCACAGTCCTCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036314242_1036314248 30 Left 1036314242 8:7708379-7708401 CCAAGTAACGTACCTGCTGTCGG No data
Right 1036314248 8:7708432-7708454 TACCCACAGTCCTCCAGGTGCGG No data
1036314244_1036314248 18 Left 1036314244 8:7708391-7708413 CCTGCTGTCGGCAGATCTGAGCT 0: 27
1: 52
2: 35
3: 43
4: 215
Right 1036314248 8:7708432-7708454 TACCCACAGTCCTCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036314248 Original CRISPR TACCCACAGTCCTCCAGGTG CGG Intergenic
No off target data available for this crispr