ID: 1036314581

View in Genome Browser
Species Human (GRCh38)
Location 8:7710534-7710556
Sequence GCTCGTTTACGACCCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036314581_1036314586 -9 Left 1036314581 8:7710534-7710556 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1036314586 8:7710548-7710570 TAAACGAGCTGCCGAGGAAGGGG No data
1036314581_1036314587 -6 Left 1036314581 8:7710534-7710556 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1036314587 8:7710551-7710573 ACGAGCTGCCGAGGAAGGGGTGG No data
1036314581_1036314588 -1 Left 1036314581 8:7710534-7710556 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1036314588 8:7710556-7710578 CTGCCGAGGAAGGGGTGGAATGG No data
1036314581_1036314585 -10 Left 1036314581 8:7710534-7710556 CCCGTTTTGGGTCGTAAACGAGC No data
Right 1036314585 8:7710547-7710569 GTAAACGAGCTGCCGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036314581 Original CRISPR GCTCGTTTACGACCCAAAAC GGG (reversed) Intergenic
No off target data available for this crispr