ID: 1036335580

View in Genome Browser
Species Human (GRCh38)
Location 8:7867640-7867662
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 2, 1: 0, 2: 2, 3: 27, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036335569_1036335580 23 Left 1036335569 8:7867594-7867616 CCTGGCAAGATGGTCCTGGAAGG 0: 2
1: 0
2: 1
3: 21
4: 176
Right 1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG 0: 2
1: 0
2: 2
3: 27
4: 319
1036335573_1036335580 9 Left 1036335573 8:7867608-7867630 CCTGGAAGGAGGGAGATTTGTGT 0: 2
1: 0
2: 0
3: 26
4: 276
Right 1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG 0: 2
1: 0
2: 2
3: 27
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
901201841 1:7471620-7471642 CAGTGGGTCAGGGGAGGAGCAGG + Intronic
901226102 1:7613796-7613818 CGATGGGTATTGGGGCAAGCTGG + Intronic
901335778 1:8447836-8447858 CAGGATGTATTCGGAGAAGCAGG - Intronic
901659355 1:10788972-10788994 CAGTGGCCACTGTGAGAAGCAGG - Intronic
901758737 1:11457045-11457067 CAGTGGGTGGTGGGTGCAGCTGG + Intergenic
902394995 1:16127724-16127746 CAGTGGCTGGTGGGAGGAGCGGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903646470 1:24899070-24899092 CAGTGGGGATTGGGAGTAAGCGG - Intergenic
904276427 1:29387643-29387665 CAGGGGGTCTGGGGAGGAGCAGG + Intergenic
904392883 1:30197372-30197394 CAGTGGGTAAGGGGTGGAGCAGG - Intergenic
906638762 1:47428302-47428324 CTGTGGAGATTGGGAGATGCTGG + Intergenic
906671234 1:47656637-47656659 CAGTGGGTAGCGGGAGAGACTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910589791 1:88918527-88918549 CAGTGAGTAGTGGGAGCAGTGGG + Intergenic
910891086 1:92020929-92020951 AACTGGCTATTGGCAGAAGCAGG + Intergenic
912588046 1:110784705-110784727 TAGTGGGAATTGAGAGAAACAGG - Intergenic
913338342 1:117732107-117732129 GAGTGGGTATGAGGAGATGCTGG + Intergenic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916671652 1:167027531-167027553 CATAGGTTATTGGGAGAAGGTGG - Intergenic
916967449 1:169964642-169964664 GGGTGGGTATTGGGAAAAGAGGG + Intronic
918775242 1:188620433-188620455 AACTGGGTAATGGCAGAAGCTGG + Intergenic
918940421 1:190988562-190988584 CAGTGGTTACTTGGAGAAGAGGG - Intergenic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920799267 1:209172562-209172584 CTGTGGGGACTGGGAGGAGCGGG + Intergenic
921046254 1:211479875-211479897 CACAGGGCCTTGGGAGAAGCTGG - Intronic
921525062 1:216207338-216207360 CAGTGGGCATTTGGAGAATCAGG + Exonic
921828412 1:219700099-219700121 CAGGGAGTAAGGGGAGAAGCGGG + Intronic
921959860 1:221023240-221023262 CAGTGGGAATTGGTGGATGCTGG - Intergenic
922619630 1:226981812-226981834 CTGTGTGTATTGGGAGGCGCTGG + Intronic
1067448563 10:46367711-46367733 CAGTGGGTATCGTGGGCAGCAGG - Intergenic
1067588811 10:47493054-47493076 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1067635936 10:48001145-48001167 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1067993670 10:51244490-51244512 CAGGGGGAATTGGGAGGAGGAGG - Intronic
1068493994 10:57761890-57761912 CAGTGTGTTTTGAAAGAAGCTGG + Intergenic
1069615729 10:69805049-69805071 CAGAGGGAATTGGGAGAACTGGG + Intronic
1070132500 10:73665152-73665174 CAGTGGGTATCGTGGGCAGCAGG + Intergenic
1070517002 10:77217429-77217451 CAGTTGATGTTGGGAGAAGTTGG - Intronic
1071609183 10:87018924-87018946 CAGTGGGTATCGTGGGCAGCAGG - Intergenic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1073614750 10:104982426-104982448 CAGTAGCTATTGGCAGAAACAGG + Intronic
1074391926 10:113065154-113065176 CACTGGGTACTAGGAGTAGCTGG - Intronic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074572091 10:114633300-114633322 TGGTGGGTCTGGGGAGAAGCGGG + Intronic
1075931621 10:126301608-126301630 CAGTGGATTTTTGGAGAAGCAGG + Intronic
1076292870 10:129361224-129361246 GAGTGGGTATTGGAAGGAGTCGG + Intergenic
1076402470 10:130193061-130193083 GAGTGGGGCTTTGGAGAAGCAGG - Intergenic
1077911685 11:6577473-6577495 CACTGGGTAGTGGAAGAGGCTGG - Intronic
1078866439 11:15302376-15302398 AAGTGGGGAGTTGGAGAAGCAGG - Intergenic
1080684329 11:34502787-34502809 CAGTGGGTGGTGGGAGGAGAAGG + Intronic
1081284334 11:41248988-41249010 CAGTGGCTATAGTGAGAAGTGGG - Intronic
1082820333 11:57540616-57540638 CAGTGGGGACTGGAAGATGCAGG + Intergenic
1085751113 11:79162017-79162039 CAGGGGGTACTGGGTGAGGCAGG - Intronic
1086123067 11:83320578-83320600 CAGTGGTGGTTGGGAGAAGTGGG - Intergenic
1086989547 11:93287990-93288012 CAGTGGGTCTAGGGAACAGCTGG + Intergenic
1087128400 11:94648116-94648138 CAATGGGGATTTGGGGAAGCAGG + Intergenic
1087364590 11:97202491-97202513 CAGAGGGCATGGGGAGCAGCAGG + Intergenic
1087486662 11:98765277-98765299 CAGTGGGCATTGAGAGAGCCAGG + Intergenic
1088806331 11:113356554-113356576 CAGTGTGTGTTTGTAGAAGCTGG + Intronic
1088908871 11:114175693-114175715 CAGTGGGAAATGAGAGAGGCAGG + Intronic
1089527486 11:119107007-119107029 CTGGGGGTGTTGGGAGAAGGGGG + Intronic
1090631399 11:128652288-128652310 TAGTGGGTATTTGGAGAACTGGG - Intergenic
1090975896 11:131679617-131679639 CAGAGGGAAATGGGAGAAACTGG - Intronic
1091209292 11:133842915-133842937 CAGTGGGTGTGGGGTGATGCAGG - Intronic
1091836860 12:3592233-3592255 CAGTGGGTGTAGGGAGCATCAGG - Exonic
1092104528 12:5912193-5912215 CAGTGGGTCTAGTGAAAAGCAGG - Intronic
1093653482 12:21670678-21670700 AAGTGGCACTTGGGAGAAGCTGG - Intronic
1094752508 12:33428435-33428457 CAATGGGTATTCACAGAAGCTGG + Intronic
1095195621 12:39312380-39312402 CAGTGGGGGTTGGGAGAGGTGGG + Intronic
1096113923 12:49044158-49044180 CAGTGGGGCCTGGGAGAAGGTGG - Intronic
1096589374 12:52647333-52647355 CAGTGAGTATTGAGGGCAGCTGG - Intronic
1096658621 12:53107116-53107138 CAGTGGGGACTGTGACAAGCAGG - Intronic
1098165578 12:67694173-67694195 CACAGGGTAGTGGGAGAAGCAGG + Intergenic
1098849809 12:75582437-75582459 CAGTTGGTATTGTGAAAACCTGG - Intergenic
1099881666 12:88474791-88474813 CAATGTGCATTGGGAGAAGAGGG + Intergenic
1100746353 12:97650559-97650581 GAGTAGCAATTGGGAGAAGCAGG - Intergenic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102786491 12:115609243-115609265 GAGTGGATATTGGCAGAAGGGGG - Intergenic
1103247524 12:119470790-119470812 CACAGGGTAATGGGAGAGGCAGG - Intronic
1103742104 12:123097837-123097859 CAGTGGGTATGAGGAACAGCTGG + Intronic
1103750186 12:123153078-123153100 CAGTGGGTGTTAGGAGATGTAGG - Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104940822 12:132393930-132393952 CAGCTGGTGGTGGGAGAAGCAGG - Intergenic
1107016235 13:35709780-35709802 AAGTGGGTATTGGGAGAGGCAGG - Intergenic
1107345126 13:39452157-39452179 CAGTGGGGAGTGGGACCAGCTGG - Intronic
1108497148 13:51036194-51036216 CAGAGGTTCTTGGGAGAAGGGGG - Intergenic
1109144967 13:58768219-58768241 CAGTGGCTAGGGGGAGAAGGAGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110390393 13:74966970-74966992 CAGCGGGAAGTGTGAGAAGCTGG + Intergenic
1110468908 13:75835338-75835360 CTGTGAGTATTTGGAGAAGTAGG + Exonic
1111939491 13:94594826-94594848 CAGTGGCTAGTGGAAGAAGTGGG - Intronic
1112326057 13:98443546-98443568 GAGTGGGAACTGGGAGAGGCTGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112785764 13:102950542-102950564 CAGTGGGACTTGGGAGACGAAGG - Intergenic
1112918857 13:104585298-104585320 CAGTGATTATTGGCAGAAGAAGG + Intergenic
1113854845 13:113437477-113437499 CAGTGGGGCTTGGGAGAGGCAGG - Intronic
1113928730 13:113955080-113955102 CAGTGGGGATGAGGAGCAGCTGG + Intergenic
1114437981 14:22723880-22723902 AAGTGGATAGAGGGAGAAGCTGG - Intergenic
1114990123 14:28276405-28276427 CAGTGAGTATTGGGACCACCTGG + Intergenic
1118302190 14:64625837-64625859 CAGGGGGTGCGGGGAGAAGCTGG - Intergenic
1119654434 14:76407051-76407073 CAGTGGCTGTTGGGAGAATCAGG + Intronic
1119996667 14:79261157-79261179 CAGTGGGAATTGGGAGACACAGG + Intronic
1120949120 14:90024572-90024594 CAGTGGGTATTGTGTGCAGTAGG + Intronic
1123007703 14:105332392-105332414 CAGTGGGGAGTGAGAGGAGCAGG + Intronic
1125721934 15:41849374-41849396 GAGTGGGGATTGGGGAAAGCAGG + Intronic
1126907900 15:53387079-53387101 CAGTGTGTTAAGGGAGAAGCAGG + Intergenic
1127577255 15:60303732-60303754 CAATGGGTAGTGGGAGAAGTGGG - Intergenic
1127634753 15:60858573-60858595 CAGCGGGGATGGGGTGAAGCAGG + Intronic
1130413465 15:83667679-83667701 GAGTGGGTCTTGGAAAAAGCAGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131156676 15:90080099-90080121 CCGTGGGGAGTGGGAGAAGTGGG + Exonic
1131883020 15:96878554-96878576 CAGTGGTTCTCAGGAGAAGCTGG - Intergenic
1132607511 16:799823-799845 GAGTGGGTAGGGGGAGAGGCAGG - Intronic
1133211501 16:4265713-4265735 CACTGGGTTTTGTGAGAATCAGG - Intronic
1133378992 16:5314191-5314213 CAGTGGGTATTGGATGGAGTTGG + Intergenic
1135204429 16:20470988-20471010 CAGTGGGTGGTGGGAAAAGATGG + Intronic
1135214564 16:20553983-20554005 CAGTGGGTGGTGGGAAAAGATGG - Intronic
1135728564 16:24875892-24875914 CAGAGGGAATTGGGAGAAAATGG + Intronic
1137873410 16:51972197-51972219 CAGAGAGTATTGGCAGAGGCTGG - Intergenic
1138023756 16:53506177-53506199 CAGTGGGAAATGGGAAAATCTGG + Intergenic
1138030229 16:53553947-53553969 CAGTGGCTTTTGGCAGATGCGGG + Intergenic
1140021185 16:71240441-71240463 CAGACGGTGTTGGGAGAAACTGG - Intergenic
1141005168 16:80345144-80345166 CAGTGGGTTTAGGTAGGAGCTGG - Intergenic
1141127282 16:81409548-81409570 GAGGGGGTATTGGGAGAAGCAGG + Intergenic
1141151370 16:81566614-81566636 CATTGGGTCCTAGGAGAAGCAGG - Intronic
1141453194 16:84119479-84119501 CAGTGAGTATAGCGAGAGGCTGG - Intergenic
1142326446 16:89418474-89418496 CAGTGGGTCATGGGAGAGGAAGG - Intronic
1142468176 17:147670-147692 CAGCGGGCAGTGGGAGAGGCTGG - Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143777408 17:9208649-9208671 TCTTGGGTATTAGGAGAAGCCGG - Intronic
1145964393 17:28906595-28906617 CAGTTGGAATGGGGAGATGCAGG - Intronic
1146978863 17:37140960-37140982 CAGAGGCTACTGGGAGAAGAAGG - Intronic
1148051383 17:44771668-44771690 CAGTGAGTATGGGGAGGGGCCGG + Exonic
1148777880 17:50105740-50105762 GAGTGGGCTTTGGGAGGAGCAGG + Intronic
1149250327 17:54760839-54760861 GAGTGGGGACTGGGAGAAGTGGG - Intergenic
1150152110 17:62818564-62818586 CAGAGAATATTGGGAGGAGCAGG + Intergenic
1151261804 17:72921649-72921671 CAGGGGCTATTTTGAGAAGCTGG - Intronic
1151618024 17:75227126-75227148 AAGTGGGTAATGGCAGAAGATGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152747695 17:82048898-82048920 CCGTGGGTACAGGGAGAAGCCGG + Intronic
1153056348 18:949959-949981 CAGTGGGGAGTGGCAGCAGCAGG + Intergenic
1153063039 18:1013752-1013774 GAGTGGGTTTTGGAGGAAGCTGG + Intergenic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1159149596 18:64504462-64504484 AACTGGGTATTGGGAGAAGTTGG + Intergenic
1159880987 18:73858346-73858368 CAGTGGGTGTTTGGAGAAGGAGG - Intergenic
1160932614 19:1577846-1577868 CAGCGGGCATGGGGAGGAGCTGG + Exonic
1161168607 19:2801997-2802019 ATGTGGGTATTGGGAGATGTGGG - Intronic
1161206307 19:3042852-3042874 CAGTGGGGACTTGGAGAAGGAGG + Intronic
1161473990 19:4474312-4474334 GGGCGGGTCTTGGGAGAAGCGGG + Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162241809 19:9361279-9361301 CAGTGGGAATTGTCAGCAGCAGG + Intronic
1162558404 19:11401906-11401928 GAGGGGGTCTTGGGAGGAGCTGG + Intronic
1163032368 19:14553059-14553081 CAGTGGGAAGTTGGAGAACCTGG - Intronic
1165048629 19:33126732-33126754 CGGTGGGTAGTGGGAGATGGAGG + Exonic
1165759205 19:38310695-38310717 CAGTGAGCATTGGGAGGCGCAGG - Intronic
1165856399 19:38881242-38881264 CAGTGGGAGTTGGGAGCAGTGGG + Intronic
1166449038 19:42881723-42881745 CAGTTGGGCTTGGGAGCAGCAGG + Intronic
1167724204 19:51199790-51199812 CACTGGGTTTTGGGAGAAGGGGG + Intergenic
925274518 2:2639314-2639336 CAGGGGGTCATGGGAGGAGCAGG + Intergenic
926144233 2:10386964-10386986 GAGTGGCCAGTGGGAGAAGCGGG + Intronic
928423343 2:31157225-31157247 CAGTTGGTCTTGGGAGAAGTCGG - Intergenic
930110868 2:47677407-47677429 CAATGGATAGTGGGAAAAGCAGG + Intergenic
930164838 2:48194808-48194830 CAGTGGGGATGGGGAAGAGCAGG - Intergenic
930376138 2:50569146-50569168 TAGTGGGGGTTGGGAGAAGTGGG + Intronic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933785541 2:85838369-85838391 CAGGGGGTTATTGGAGAAGCCGG - Intergenic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934606586 2:95699802-95699824 CAGTGCATCCTGGGAGAAGCAGG - Intergenic
934771994 2:96913112-96913134 CAGAAGGTTTTGGGAGAGGCAGG + Intronic
935263713 2:101376668-101376690 CTGTGAGTCTTGTGAGAAGCTGG - Intronic
936539990 2:113341930-113341952 CAGTGCATCCTGGGAGAAGCAGG - Intergenic
937684683 2:124682344-124682366 CAGCTGGTTTGGGGAGAAGCAGG - Intronic
938048033 2:128140643-128140665 CAGTGGGTGGTGGGTGTAGCTGG - Intronic
939095204 2:137826448-137826470 CAGTGGTTAATGGGATAACCTGG + Intergenic
939568724 2:143814902-143814924 CAGAAGGAATTGGGTGAAGCAGG + Intergenic
939609676 2:144295156-144295178 CAGGGCGCATTGAGAGAAGCTGG - Intronic
939660589 2:144883780-144883802 CAGTGGGTAGAGGCAGCAGCAGG - Intergenic
942243533 2:173986287-173986309 CCTTGGGTATTTGGAGAAGTAGG + Intergenic
942395124 2:175539022-175539044 AAGTTGTTATTTGGAGAAGCTGG - Intergenic
942646890 2:178121835-178121857 CATTGAGAATTGGAAGAAGCAGG - Intronic
943454691 2:188090815-188090837 CAGTGTGTATTGGGAAAATAGGG - Intergenic
946153468 2:217791569-217791591 GAGTGGGTATTGGGAACAACTGG - Intergenic
948062504 2:235052091-235052113 CAGTGGGGCTTAGGAGAGGCAGG - Intronic
949026300 2:241767978-241768000 CAGTGGGCCTTGGCAGCAGCAGG - Exonic
1170166784 20:13367949-13367971 CAGTGGCCATTTGGAGATGCAGG - Intergenic
1170357369 20:15507323-15507345 AGGAGGGAATTGGGAGAAGCAGG - Intronic
1170734297 20:19000715-19000737 CATTTGGTATTGGGAGAATAAGG + Intergenic
1170825752 20:19793605-19793627 CAAAGGGTTTTGGGAGATGCTGG + Intergenic
1170977342 20:21177799-21177821 CATACGGTATTGGGAGAAACTGG - Intronic
1170990941 20:21301532-21301554 CAGTAGGCAATGAGAGAAGCAGG - Intergenic
1171146444 20:22787984-22788006 CACTGGGCAATGTGAGAAGCTGG + Intergenic
1172779137 20:37425345-37425367 CAGTGGATCCTGGGAGCAGCTGG + Intergenic
1172817254 20:37697428-37697450 CATAGGCTATTGGTAGAAGCTGG + Intronic
1172960456 20:38795558-38795580 CACTGTCTAATGGGAGAAGCAGG + Intergenic
1173334321 20:42100626-42100648 GAGGGGGTGTTGGGAGAAGTGGG + Intronic
1173502144 20:43561805-43561827 TAGTGGGTAAATGGAGAAGCAGG + Intronic
1173539850 20:43843127-43843149 CAGTCAGTAATGGGAGGAGCTGG + Intergenic
1173667040 20:44770462-44770484 CTGTGTGTATTGGGGGAAACTGG + Intronic
1175332850 20:58176874-58176896 CAGAGGGGCTTTGGAGAAGCAGG + Intergenic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1176025189 20:62982076-62982098 CTCTGGGCATTGGGAGAAGGGGG + Intergenic
1177572629 21:22906960-22906982 CAGTGGGAATTTAGAGAATCAGG - Intergenic
1178352287 21:31880868-31880890 CACTGGGCAGAGGGAGAAGCTGG + Intronic
1178819459 21:35962113-35962135 GTGTGGGTAAAGGGAGAAGCAGG - Intronic
1179514483 21:41897382-41897404 CAGTGAGTGCTGGGCGAAGCGGG - Intronic
1180168017 21:46040124-46040146 CAGAGGGTCCTGGGAGAGGCTGG - Intergenic
1180202581 21:46234184-46234206 TAGTGTGTGTTTGGAGAAGCAGG + Intergenic
1181271938 22:21664195-21664217 GAGTGGGGACTGGGAGAAGAGGG + Intronic
1181744733 22:24948115-24948137 CAGTTGGTATTGCCAGAAGCAGG + Intergenic
1181755633 22:25022450-25022472 CAGTGAGCATTGGCAGAAGTAGG + Intronic
1183858807 22:40654103-40654125 CACGGGGTATGGGGGGAAGCAGG + Intergenic
951129212 3:19022015-19022037 GTGTGTGTATTTGGAGAAGCAGG - Intergenic
952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG + Intergenic
952712316 3:36443816-36443838 CACTGGGTAGTGGGAGAAGTTGG + Intronic
952752881 3:36839685-36839707 CAGTTGGTTCTGGGAGCAGCTGG + Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
956878854 3:73490445-73490467 CAGTGGGTGTTGAGAGGGGCTGG - Intronic
959071452 3:101705479-101705501 AAGTGGGTAATGGTTGAAGCTGG + Intergenic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960633174 3:119754069-119754091 CACTGGTTATGGGTAGAAGCTGG + Intronic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
963235947 3:142956251-142956273 CATGGTGTACTGGGAGAAGCAGG + Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
966942341 3:184754907-184754929 AAGAAGGTATTGGGAGAAGAAGG + Intergenic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967482596 3:189990989-189991011 CAGTGGCCATTGGTGGAAGCAGG + Intronic
968119517 3:196115107-196115129 AGGTGGGTACTGGGAGCAGCAGG + Intergenic
968186171 3:196634709-196634731 AAGTGGGGACTGGGAGAAGTGGG + Intergenic
968186186 3:196634756-196634778 AAGTGGGGACTGGGAGAAGTGGG + Intergenic
968867056 4:3219904-3219926 CAGGGAGTGCTGGGAGAAGCAGG - Intronic
971296370 4:25396898-25396920 CAGTAAGTATTGGGAGTACCTGG + Exonic
971740406 4:30512481-30512503 CAGTGGCTATTTGTAGCAGCTGG + Intergenic
971839639 4:31834812-31834834 CAGAGGGAGGTGGGAGAAGCAGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
975319099 4:72989760-72989782 CAGAGGGCACTGGGAGTAGCTGG - Intergenic
976227012 4:82802333-82802355 CAGTGGGGATTTGGAGAAATTGG - Intergenic
976892837 4:90071369-90071391 CTCTAGGTATTGGGAGAAGCAGG + Intergenic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
981055898 4:140361035-140361057 TAGAGGTTTTTGGGAGAAGCAGG + Intronic
982612468 4:157593325-157593347 CTGTGGGTAATGGGAGAGGCTGG - Intergenic
982759744 4:159267073-159267095 CAGTGTGTATAGGGAGAGGGAGG + Intronic
983189505 4:164740113-164740135 CTGTGGCTCTAGGGAGAAGCTGG - Intergenic
984762693 4:183376656-183376678 CAGTGGGGAGGGGGAGGAGCGGG - Intergenic
985912932 5:2897247-2897269 AGCTGGGGATTGGGAGAAGCTGG + Intergenic
985987679 5:3530608-3530630 CAGTGGGTGTCGGGATATGCAGG + Intergenic
986019019 5:3783692-3783714 CAGTGGGTCTGCTGAGAAGCAGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
991601507 5:68355570-68355592 CTGGGGGTCTTGGGATAAGCGGG - Intergenic
992506421 5:77391572-77391594 CACTAGGTACAGGGAGAAGCAGG - Intronic
996817493 5:127589837-127589859 CAGTGGGTCCTGGGAGGAACTGG - Intergenic
998392126 5:141794038-141794060 CAGAGGAGATTGGGAGGAGCAGG - Intergenic
999676281 5:154006352-154006374 CGGTGGGTATGGGTAGAAGGTGG + Intronic
1002414135 5:179109965-179109987 CAGCAGGTATAGGGAGAAGCAGG - Intergenic
1002468807 5:179422445-179422467 CCTTGGGTGTTGGGAGAGGCTGG - Intergenic
1004693442 6:18012188-18012210 CAGTGGGGAGTGGGGGGAGCTGG - Intergenic
1007214421 6:40226298-40226320 CTGTGTATATTGGGAGAAGCGGG + Intergenic
1007262680 6:40574923-40574945 AAGTGTGTTTTGGGAGAAGCAGG - Intronic
1007366171 6:41395338-41395360 CAGAGGGTATTGCTACAAGCTGG - Intergenic
1007786557 6:44283364-44283386 CAGTGGGGAGGTGGAGAAGCAGG + Intronic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1011486518 6:87847498-87847520 AAGAGGGTATTGGGAGAATCTGG - Intergenic
1011639964 6:89409614-89409636 GAGTGGGGATTGGGAGGAGGAGG - Intronic
1012979343 6:105813252-105813274 CTGTAGGTACAGGGAGAAGCAGG + Intergenic
1013084667 6:106846301-106846323 CAGTGGGTATTGGGTCATGGTGG - Intergenic
1013328558 6:109073490-109073512 CTGTGGGTCTTAGGAGAAGACGG - Intronic
1013761597 6:113524824-113524846 CAGAGGGTAATGAGAGAAGAAGG + Intergenic
1015264926 6:131281366-131281388 CATTTGGTATTTGCAGAAGCAGG - Intronic
1015546438 6:134366566-134366588 CAGTGGGAATTAGGAGACTCTGG - Intergenic
1015639530 6:135316175-135316197 CAGTGGATCTTGGAGGAAGCAGG - Intronic
1015921735 6:138273187-138273209 CATTGGGCCTTGAGAGAAGCGGG + Intronic
1016378776 6:143451136-143451158 AAGGGGGCATTGGGAGAAGGGGG + Intronic
1017054291 6:150424004-150424026 CAGTGGCTGCTGGGAGCAGCAGG + Intergenic
1017361713 6:153579979-153580001 GAGTGGGGTTTGGGAGATGCTGG + Intergenic
1018134983 6:160770589-160770611 CAGTGGAAATTGGGAGAGCCAGG - Intergenic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1023354908 7:39356860-39356882 CAGTGGGTTTTGGGAAATGGGGG + Intronic
1023854333 7:44172627-44172649 CAGTAGGTAGTGGGAGGAGAGGG + Intronic
1028035618 7:85978105-85978127 GAGTGGGTGTTGGGAGTGGCAGG + Intergenic
1028105023 7:86867185-86867207 TCGTGGGTAGAGGGAGAAGCAGG - Intergenic
1029393182 7:100288820-100288842 CAGTGGGTATGGGGAGCCGTGGG + Intergenic
1030265214 7:107614118-107614140 CAGTCTGTCTTGGGAGAAACTGG - Intronic
1031633216 7:124069245-124069267 GAGTGGGGAGTGTGAGAAGCAGG + Intergenic
1031648368 7:124254971-124254993 CAGTAGCTATAGGAAGAAGCTGG + Intergenic
1033475589 7:141688976-141688998 CAGTAAGTATTAGAAGAAGCAGG - Intronic
1033591824 7:142815114-142815136 CAGTGGGTGGTGGGAGATACAGG + Intergenic
1034047421 7:147944453-147944475 CAGATGGTCTTGTGAGAAGCAGG - Intronic
1034469437 7:151247672-151247694 GGGTGGGGAATGGGAGAAGCAGG - Intronic
1034722648 7:153308878-153308900 CAGTGGGCATTGCCAGAAACGGG - Intergenic
1035262745 7:157672034-157672056 CAGAGGGTGCTGGGAGCAGCCGG + Intronic
1035299379 7:157887413-157887435 GAGTGGGTACTGGGGGAAGTGGG - Intronic
1035299402 7:157887476-157887498 GAGTGGGTACTGGCAGCAGCAGG - Intronic
1035299413 7:157887522-157887544 GAGCGGGTACTGGGGGAAGCGGG - Intronic
1035299511 7:157887817-157887839 AAGCGGGTACTGGGTGAAGCGGG - Intronic
1035729479 8:1844203-1844225 GTGTGGGTCTTGGGAGATGCTGG + Intronic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038028335 8:23613021-23613043 CAGTGAGTATTGCTAGAATCAGG + Intergenic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1039130176 8:34254963-34254985 TAATGGGTATTAGGAGCAGCTGG + Intergenic
1040105565 8:43539683-43539705 CCCTGGGAATTGGGAGAGGCAGG + Intergenic
1042177949 8:66056182-66056204 GATTGGGTATTGGGAAAAGCTGG - Intronic
1042468101 8:69151804-69151826 CAGTTGGTATTCCCAGAAGCTGG + Intergenic
1043420275 8:80090439-80090461 CAGTGGGGATGGGGAGGGGCGGG + Intronic
1043606768 8:82010064-82010086 AAGTGGGATTTGGGAGAAGGGGG + Intergenic
1045767018 8:105684459-105684481 CAGCGGGTATGGGGAAAAGGTGG + Intronic
1047302109 8:123622377-123622399 CAGAGGGAATAGGAAGAAGCAGG + Intergenic
1048176113 8:132154242-132154264 CAGTTTGTATGGGGAGAAGGGGG - Intronic
1049133609 8:140872648-140872670 CTGTGGGGATTGGGAAGAGCTGG + Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1052144523 9:25031717-25031739 CATTGAGTATTTGGAGAAACTGG + Intergenic
1052346300 9:27413118-27413140 CAGTCAGTAGTGGGAGAAGAAGG + Intronic
1054795120 9:69294296-69294318 CAGTTGGTAATGGTTGAAGCTGG + Intergenic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055560225 9:77515011-77515033 CAGTGAGGCCTGGGAGAAGCAGG + Intronic
1055660132 9:78494998-78495020 CAGTGGGAATTGGCAGAGGGAGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057973025 9:99575570-99575592 GTGTGGGTAATGGGATAAGCAGG + Intergenic
1059268227 9:113056028-113056050 CAGTGGGTAATGGAGGAATCGGG - Intronic
1061033206 9:128099261-128099283 CAGTGGGCACTGGGGGTAGCAGG - Intronic
1061250476 9:129423395-129423417 CAGGGGGCAGTGGGAGAAGAGGG + Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1062278795 9:135742934-135742956 CAGCGGGTACTGGGAGGTGCCGG - Intronic
1062286967 9:135777695-135777717 GAGTGGGTGTGGGGAGGAGCTGG - Intronic
1062551547 9:137089772-137089794 GAGTGGGCCTTGGGAGAAGGAGG + Intronic
1185545119 X:937378-937400 CAGTGGGTGCTGGGAGTCGCTGG + Intergenic
1186580394 X:10811468-10811490 CAGTGTGTAAGTGGAGAAGCTGG + Intronic
1187222336 X:17340324-17340346 CAGTGGCCATTGGGAGATGATGG - Intergenic
1187449518 X:19384345-19384367 CAGTGGGGACTGGGGGAAGGTGG + Intronic
1189365574 X:40385367-40385389 CAGTGGGTAAGAGAAGAAGCTGG + Intergenic
1189865173 X:45320383-45320405 CAATGGCTGTGGGGAGAAGCAGG + Intergenic
1189897148 X:45667528-45667550 GAGTGGGCATTGGGAGGACCAGG + Intergenic
1190039617 X:47059293-47059315 CAGAGGCTATTGGGAACAGCTGG + Exonic
1191820928 X:65306996-65307018 AAGTGGGTATGGTGAGAGGCTGG + Intergenic
1192237297 X:69304057-69304079 CCATGGGCATTGGGAGAAGGGGG - Intergenic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1195533337 X:105982467-105982489 CAGTGGGGAGAGGGAGAGGCTGG + Intergenic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196190004 X:112784272-112784294 CAGAGTGTACTTGGAGAAGCTGG - Intronic
1196649010 X:118149851-118149873 CAGTGGATACGGGGAGAAGATGG - Intergenic
1201052352 Y:9950386-9950408 AGGTGGGTAGTGGGAGAAGGTGG + Intergenic
1201866057 Y:18656605-18656627 AAGTGGGTCCTGGGAGTAGCTGG + Intergenic