ID: 1036335811

View in Genome Browser
Species Human (GRCh38)
Location 8:7869019-7869041
Sequence CTATGTTTGTGGAAAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036335804_1036335811 24 Left 1036335804 8:7868972-7868994 CCTGTGACCTGTGCACCATTTAT No data
Right 1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG No data
1036335803_1036335811 30 Left 1036335803 8:7868966-7868988 CCAGAGCCTGTGACCTGTGCACC No data
Right 1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG No data
1036335807_1036335811 -2 Left 1036335807 8:7868998-7869020 CCTGAATATTTAGCTCGATGCCT No data
Right 1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG No data
1036335806_1036335811 9 Left 1036335806 8:7868987-7869009 CCATTTATTTTCCTGAATATTTA No data
Right 1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG No data
1036335805_1036335811 17 Left 1036335805 8:7868979-7869001 CCTGTGCACCATTTATTTTCCTG No data
Right 1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036335811 Original CRISPR CTATGTTTGTGGAAAGAAGG AGG Intergenic
No off target data available for this crispr