ID: 1036338170

View in Genome Browser
Species Human (GRCh38)
Location 8:7891769-7891791
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 7, 1: 0, 2: 2, 3: 21, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036338166_1036338170 13 Left 1036338166 8:7891733-7891755 CCACCAGTAGCAATAACCGTATC No data
Right 1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG 0: 7
1: 0
2: 2
3: 21
4: 133
1036338165_1036338170 25 Left 1036338165 8:7891721-7891743 CCAAACACTGTACCACCAGTAGC No data
Right 1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG 0: 7
1: 0
2: 2
3: 21
4: 133
1036338167_1036338170 10 Left 1036338167 8:7891736-7891758 CCAGTAGCAATAACCGTATCTTT No data
Right 1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG 0: 7
1: 0
2: 2
3: 21
4: 133
1036338169_1036338170 -3 Left 1036338169 8:7891749-7891771 CCGTATCTTTAAGCTGGTTCTTT No data
Right 1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG 0: 7
1: 0
2: 2
3: 21
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036338170 Original CRISPR TTTCTATTGTCACCAAACCC TGG Intergenic
903451056 1:23453895-23453917 TTTCCTGTGTCACCAACCCCTGG + Intronic
904869823 1:33609549-33609571 TGTCTATAGCCTCCAAACCCAGG - Intronic
905138707 1:35822920-35822942 TTTCTTTTGCCATCATACCCAGG - Exonic
905833931 1:41100232-41100254 TCTCTTTTATCACCATACCCGGG - Intronic
907355592 1:53870618-53870640 TTTCTATTGTCTCCAAAATGTGG + Intronic
908343827 1:63210990-63211012 TTTCTATTGTCATTCCACCCAGG - Intergenic
908690738 1:66776768-66776790 TTTCTATTTTTACAAACCCCAGG + Intronic
908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG + Intergenic
915253119 1:154604625-154604647 TTTGCTGTGTCACCAAACCCTGG - Intronic
917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG + Intronic
920804872 1:209223534-209223556 TTCCTATTCTTACTAAACCCAGG - Intergenic
923805783 1:237256409-237256431 TTTCTATAATCACCATACACAGG - Intronic
924350697 1:243112107-243112129 TATGTGTTGTAACCAAACCCAGG + Intergenic
1064010165 10:11729332-11729354 TTGCTATTGTAACCTAACCCAGG - Intergenic
1066028654 10:31393629-31393651 TTTTTAATGTCACGAAAACCAGG - Intronic
1067131098 10:43566174-43566196 TTTCTATTTTCAGCTAATCCTGG - Intronic
1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG + Intergenic
1069084971 10:64128377-64128399 TTTGTGTTGTCACAGAACCCGGG + Intergenic
1070712288 10:78691531-78691553 TTGATATTGTCAACAAATCCAGG + Intergenic
1070739214 10:78891677-78891699 TTTCTAATGTCATCAACCCTGGG + Intergenic
1071930030 10:90458632-90458654 TCTTTATTGTCCCCAAAGCCTGG - Intergenic
1073772650 10:106752262-106752284 TTTCTTTTGTCCCCAAAAGCAGG + Intronic
1074411018 10:113228718-113228740 TTTCTCTTTTCACAAAACCCTGG - Intergenic
1074457079 10:113604547-113604569 TTTCTCCTTTCACCAAACCCGGG - Intronic
1083742649 11:64719204-64719226 TTACTTTTCTCACCAAGCCCTGG - Intronic
1086419562 11:86625251-86625273 TAACTATGGTCACCAAACTCAGG - Intronic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1090753768 11:129770761-129770783 TTTCTATTGACATAAAACACAGG + Intergenic
1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG + Intronic
1092029207 12:5269832-5269854 TTTGTATTTTCAGTAAACCCGGG + Intergenic
1092733669 12:11558565-11558587 TTCCTACTGCCACCAACCCCTGG + Intergenic
1095464103 12:42472686-42472708 TTACTACTGTCACCACCCCCAGG + Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1096121935 12:49094075-49094097 TTTCCCTTGTCACCAGCCCCAGG - Intronic
1096299208 12:50411109-50411131 TTTCTACTGTAACAAACCCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098555936 12:71819107-71819129 GTTCAGTTGTCACCAAACTCTGG + Intergenic
1101217621 12:102600572-102600594 TTTCAATTTGCTCCAAACCCAGG - Intergenic
1106336942 13:28792059-28792081 TATCTGTTGTCAGCAAACACTGG + Intergenic
1108560524 13:51639062-51639084 TTTTTATTGTCACAAAATCAAGG + Intronic
1111069371 13:83144030-83144052 TTTCTATTGTCACCAGTGACAGG - Intergenic
1111523349 13:89434181-89434203 TTTCTATCTTCACCAAACATGGG - Intergenic
1113699504 13:112374263-112374285 TTTCTGCTGTGACCAAGCCCAGG + Intergenic
1118197848 14:63644633-63644655 TTTCTATTTTCAGCAGACACTGG + Intergenic
1120386877 14:83857657-83857679 TTTTTATTGTAACCAACACCTGG + Intergenic
1120471654 14:84933291-84933313 TTTCTATTGCTACAAAACCTTGG + Intergenic
1120580579 14:86243032-86243054 TATTTATTATCACCAAACACTGG + Intergenic
1122741164 14:103872243-103872265 TTGCCATTGTCACCAAGTCCAGG - Intergenic
1128307653 15:66610573-66610595 TTTCAATTGTCAACAGACCCAGG - Intronic
1128592423 15:68912456-68912478 TTTTTATTGTCACTACTCCCTGG - Intronic
1131779937 15:95845244-95845266 TTTCTCCTGTCACCAAAGACAGG - Intergenic
1135178154 16:20249815-20249837 TTCCTATTGTCTCCCAACCACGG + Intergenic
1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG + Intergenic
1139073601 16:63415441-63415463 TTTATCTTGTCACCACACACAGG - Intergenic
1139208711 16:65054999-65055021 TTGCTACAGTCACCAAAACCAGG - Intronic
1141299929 16:82805068-82805090 CTTCTACTGTTAACAAACCCGGG - Intronic
1141911075 16:87058550-87058572 TTTCTAAGATCTCCAAACCCAGG - Intergenic
1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG + Intronic
1143698719 17:8640865-8640887 TATCTATTTTCAACAAACCCAGG - Intergenic
1144245857 17:13363775-13363797 TATCTATTGTCATGAAATCCAGG + Intergenic
1149630472 17:58117773-58117795 TCTCTGATGTCAGCAAACCCTGG + Intergenic
1152191809 17:78892725-78892747 TTTCTATTGTCACAAATGCAGGG + Intronic
1154111565 18:11572865-11572887 TTTCTACTGTCCCTAAACTCAGG + Intergenic
1158638316 18:59180528-59180550 TTTCTATTGGCACCAGCCCCAGG + Intergenic
1159948122 18:74458372-74458394 TTTCTATTATCTCTAAACTCGGG - Intergenic
925709959 2:6729246-6729268 TTGCTATTGTGACCTAACTCAGG - Intergenic
926946087 2:18188932-18188954 TTTTTATATTCACAAAACCCAGG + Intronic
928756328 2:34530121-34530143 TACCTATTGTCACCAAACTAAGG - Intergenic
930686806 2:54318215-54318237 TTTCAAATGTCAGCAAACCCTGG + Intergenic
932969672 2:76525270-76525292 TTTCTATTGTCATAATACCCAGG - Intergenic
935213053 2:100954762-100954784 TTTCAACTGTCACCACACCTGGG - Intronic
935456195 2:103270149-103270171 TTTCTATTGTCACCACAGATGGG + Intergenic
939988969 2:148859465-148859487 TTTTTATTCTCACCAATCCATGG - Intergenic
940674143 2:156708314-156708336 ATTCTATGCTCACCAAGCCCTGG + Intergenic
942402838 2:175621663-175621685 TTCCTTTAGTAACCAAACCCTGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945437975 2:209841281-209841303 TTTCTAATCTCACTAAAACCAGG + Intronic
945576371 2:211534959-211534981 TTTCTATTGTTACCATCACCAGG + Intronic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
1169447469 20:5684459-5684481 TTTTTATTGCCAGCAAAGCCAGG - Intergenic
1172278621 20:33694809-33694831 TTTCTTTTGTCACTGAATCCTGG + Intergenic
1173173351 20:40744766-40744788 TTTTTATTGGAAGCAAACCCTGG - Intergenic
1173404236 20:42751352-42751374 TTTCCTTTGTCCCCAGACCCGGG + Intronic
1175473471 20:59251272-59251294 TTTCTGGTGTCACCACAGCCTGG - Intronic
1175682401 20:60999371-60999393 TTGCTTTGCTCACCAAACCCTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1179144643 21:38757122-38757144 TCTCCATTGTCACCAGCCCCTGG + Intergenic
1183032167 22:35114431-35114453 CTTTCATGGTCACCAAACCCAGG - Intergenic
949472335 3:4409383-4409405 TTTTTCTTTTCACCAATCCCAGG - Intronic
949785397 3:7734635-7734657 TTTCTTGTGTCAACAAATCCAGG + Intronic
950373078 3:12547510-12547532 TTTCTCTTGTCACCCAAGCTGGG - Intronic
953817350 3:46170329-46170351 TTGCAGTTATCACCAAACCCAGG - Intronic
956311568 3:67886590-67886612 TTCCTAATGTGACCAAAACCTGG + Intergenic
959521280 3:107325764-107325786 TTTCCCTTCCCACCAAACCCTGG + Intergenic
959551176 3:107659798-107659820 TTTCTAGTCTCACTAAACCCAGG - Intronic
967823553 3:193860607-193860629 TCTCTATACTCACCAAAACCTGG - Intergenic
968705403 4:2075261-2075283 TTTCAAGGGTCCCCAAACCCAGG + Intronic
970934892 4:21557824-21557846 TTTCTATAGTTACAAAGCCCAGG - Intronic
971687022 4:29784036-29784058 TTTGAATTGTTACCAAACTCAGG + Intergenic
971692036 4:29849306-29849328 TTTCTATTTGCCCCAATCCCTGG + Intergenic
971886205 4:32451562-32451584 TTTGTCTTGTCACCAAAGACTGG - Intergenic
975349854 4:73333133-73333155 TTATTAATGTCACCAAAACCAGG + Intergenic
976059848 4:81114310-81114332 TTTTTTTTTTCACCAAACACAGG - Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
979251239 4:118568440-118568462 TATGTGTTGTAACCAAACCCAGG - Intergenic
980870939 4:138610004-138610026 TTTCTATTTTCAGCTTACCCAGG - Intergenic
981043204 4:140242143-140242165 TTCCAAATGTCACCAATCCCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG + Intergenic
984168455 4:176332255-176332277 TTTCTAATGTGACCAAACCATGG + Intergenic
984467938 4:180124937-180124959 TTTCTGTTGCCAGCAAACCTTGG + Intergenic
985009450 4:185567694-185567716 TTTCTTTTTTCCCCAAACCAAGG + Intergenic
985181909 4:187273697-187273719 ATTCTATTCACACCAAATCCTGG - Intergenic
985182958 4:187285259-187285281 TTTCTATTCACATCAAACCGGGG + Intergenic
987026773 5:13934904-13934926 TTTCAAATGTCACTAAAGCCAGG + Intronic
987141764 5:14953660-14953682 TTTCCATTGTCACAATAACCAGG + Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
995523864 5:113035312-113035334 CTGCCATTGTCACCACACCCAGG + Intronic
996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG + Intergenic
996961764 5:129259042-129259064 TTTATATTGTTCCCAAGCCCAGG - Intergenic
998657799 5:144201629-144201651 TTTTTATTGCCACCATACCCTGG + Intronic
1000732900 5:164858381-164858403 TTTATATTGTCCCCAATCCTGGG - Intergenic
1007420040 6:41713717-41713739 TTTCTATTCTCCCCAGAGCCAGG + Intronic
1010040059 6:71370674-71370696 TTTCTATAGTCAGGTAACCCAGG - Intergenic
1010550103 6:77211397-77211419 TTTATATAGACCCCAAACCCTGG + Intergenic
1010911009 6:81556438-81556460 GTTCTAATGTGACCATACCCTGG + Intronic
1011273782 6:85607368-85607390 TTCTTATTGTCAGCAAGCCCTGG + Intronic
1011432199 6:87299656-87299678 TTTCTGTTGTCACCAAAATCTGG - Intronic
1014977223 6:127902400-127902422 TTTCTTTAGTAACCAAACCCAGG + Intronic
1017970267 6:159306299-159306321 TTTCTATTGTTTCCCATCCCTGG - Intergenic
1018356244 6:163020898-163020920 TTGCTGTTGTCTCCAAAGCCTGG + Intronic
1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG + Intronic
1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG + Intronic
1028173954 7:87631329-87631351 TTTCCAGAGTCACCAAACCCTGG + Intronic
1031426382 7:121610487-121610509 TTTCTATTCTGATCAAACCTGGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1038056642 8:23864751-23864773 CTTCTCTAGTCACCCAACCCAGG - Intergenic
1042216057 8:66430170-66430192 TTTCTCTTGCCACCCAAGCCAGG - Exonic
1043265670 8:78265285-78265307 ATTCTGTTGTGCCCAAACCCTGG - Intergenic
1043829932 8:84975719-84975741 TTTGTGTTGCCACCAAATCCTGG - Intergenic
1044170324 8:89043431-89043453 TTTCTCTTGTTACCAAAAACGGG + Intergenic
1044762293 8:95533530-95533552 TTGCTTTTGTCACCCAAGCCGGG - Intergenic
1044838695 8:96319557-96319579 TTTATATTTTCACCAAAAACGGG + Intronic
1045116683 8:98990381-98990403 TTTCTGTTGTCAGCATACACTGG - Intergenic
1048075650 8:131067422-131067444 TGTTTATTGTCACCAAGCACTGG - Intergenic
1048563172 8:135564844-135564866 TTTCTTTTGTAATCACACCCAGG + Intronic
1049262754 8:141648617-141648639 TTGCTATTGTCACCATAACCAGG - Intergenic
1051103813 9:13553900-13553922 TTTTTATTGTAAACATACCCAGG - Intergenic
1052365117 9:27603528-27603550 TTTGTATTGTAACTGAACCCAGG - Intergenic
1052895271 9:33741790-33741812 TTTCTATTGACATAAAACACAGG + Intergenic
1055997967 9:82182215-82182237 CTTCTATTGCCTCCAAATCCTGG - Intergenic
1059628921 9:116098538-116098560 ATTCTATTGTCAATAAACTCTGG - Intergenic
1060022738 9:120146350-120146372 TTTCTGTTCTCACCTGACCCAGG + Intergenic
1060027814 9:120187708-120187730 TTTCTTTTCTCAAGAAACCCCGG - Intergenic
1188572630 X:31606668-31606690 TTTATTTTTTCACCAAACCAAGG + Intronic
1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG + Intronic
1193897009 X:87127085-87127107 TTTCTATTGTTACCATACCTGGG - Intergenic
1194711756 X:97244388-97244410 TTACTATTGTGACCTAAACCTGG + Intronic
1194767896 X:97863853-97863875 TTTCTATTATAAGCAAATCCTGG + Intergenic
1197749598 X:129955416-129955438 TTTCTATTGCCACCCATCCTTGG - Intergenic
1198008592 X:132525843-132525865 ATTAAATTGTCACCAAATCCTGG - Intergenic