ID: 1036338407

View in Genome Browser
Species Human (GRCh38)
Location 8:7893798-7893820
Sequence TGGTGGAGAAGCACCGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036338407_1036338416 28 Left 1036338407 8:7893798-7893820 CCCTACTCGGTGCTTCTCCACCA No data
Right 1036338416 8:7893849-7893871 GTGGAAAGCAGAGAAAGCCCTGG No data
1036338407_1036338415 9 Left 1036338407 8:7893798-7893820 CCCTACTCGGTGCTTCTCCACCA No data
Right 1036338415 8:7893830-7893852 GGCAGTGACGCTGACGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036338407 Original CRISPR TGGTGGAGAAGCACCGAGTA GGG (reversed) Intergenic
No off target data available for this crispr