ID: 1036340961

View in Genome Browser
Species Human (GRCh38)
Location 8:7915385-7915407
Sequence TGGCAACGGACCAGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036340961_1036340969 6 Left 1036340961 8:7915385-7915407 CCTCCCATCCTGGTCCGTTGCCA No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data
1036340961_1036340972 17 Left 1036340961 8:7915385-7915407 CCTCCCATCCTGGTCCGTTGCCA No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340961_1036340968 5 Left 1036340961 8:7915385-7915407 CCTCCCATCCTGGTCCGTTGCCA No data
Right 1036340968 8:7915413-7915435 CTTCCCAGTCGAGATGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036340961 Original CRISPR TGGCAACGGACCAGGATGGG AGG (reversed) Intergenic