ID: 1036340964

View in Genome Browser
Species Human (GRCh38)
Location 8:7915393-7915415
Sequence AAGGAAGATGGCAACGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036340964_1036340976 24 Left 1036340964 8:7915393-7915415 CCTGGTCCGTTGCCATCTTCCTT No data
Right 1036340976 8:7915440-7915462 CTCCAAGGCACCCGTGCTCAGGG No data
1036340964_1036340972 9 Left 1036340964 8:7915393-7915415 CCTGGTCCGTTGCCATCTTCCTT No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340964_1036340968 -3 Left 1036340964 8:7915393-7915415 CCTGGTCCGTTGCCATCTTCCTT No data
Right 1036340968 8:7915413-7915435 CTTCCCAGTCGAGATGTGCCTGG No data
1036340964_1036340975 23 Left 1036340964 8:7915393-7915415 CCTGGTCCGTTGCCATCTTCCTT No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340964_1036340969 -2 Left 1036340964 8:7915393-7915415 CCTGGTCCGTTGCCATCTTCCTT No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036340964 Original CRISPR AAGGAAGATGGCAACGGACC AGG (reversed) Intergenic