ID: 1036340965

View in Genome Browser
Species Human (GRCh38)
Location 8:7915399-7915421
Sequence ACTGGGAAGGAAGATGGCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036340965_1036340969 -8 Left 1036340965 8:7915399-7915421 CCGTTGCCATCTTCCTTCCCAGT No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data
1036340965_1036340975 17 Left 1036340965 8:7915399-7915421 CCGTTGCCATCTTCCTTCCCAGT No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340965_1036340968 -9 Left 1036340965 8:7915399-7915421 CCGTTGCCATCTTCCTTCCCAGT No data
Right 1036340968 8:7915413-7915435 CTTCCCAGTCGAGATGTGCCTGG No data
1036340965_1036340976 18 Left 1036340965 8:7915399-7915421 CCGTTGCCATCTTCCTTCCCAGT No data
Right 1036340976 8:7915440-7915462 CTCCAAGGCACCCGTGCTCAGGG No data
1036340965_1036340972 3 Left 1036340965 8:7915399-7915421 CCGTTGCCATCTTCCTTCCCAGT No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036340965 Original CRISPR ACTGGGAAGGAAGATGGCAA CGG (reversed) Intergenic