ID: 1036340966

View in Genome Browser
Species Human (GRCh38)
Location 8:7915405-7915427
Sequence ATCTCGACTGGGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036340966_1036340972 -3 Left 1036340966 8:7915405-7915427 CCATCTTCCTTCCCAGTCGAGAT No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1036340966_1036340975 11 Left 1036340966 8:7915405-7915427 CCATCTTCCTTCCCAGTCGAGAT No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340966_1036340976 12 Left 1036340966 8:7915405-7915427 CCATCTTCCTTCCCAGTCGAGAT No data
Right 1036340976 8:7915440-7915462 CTCCAAGGCACCCGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036340966 Original CRISPR ATCTCGACTGGGAAGGAAGA TGG (reversed) Intergenic