ID: 1036340967

View in Genome Browser
Species Human (GRCh38)
Location 8:7915412-7915434
Sequence CAGGCACATCTCGACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036340967_1036340980 25 Left 1036340967 8:7915412-7915434 CCTTCCCAGTCGAGATGTGCCTG No data
Right 1036340980 8:7915460-7915482 GGGCAGCAAGCTCCAGCATGTGG No data
1036340967_1036340975 4 Left 1036340967 8:7915412-7915434 CCTTCCCAGTCGAGATGTGCCTG No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340967_1036340972 -10 Left 1036340967 8:7915412-7915434 CCTTCCCAGTCGAGATGTGCCTG No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340967_1036340976 5 Left 1036340967 8:7915412-7915434 CCTTCCCAGTCGAGATGTGCCTG No data
Right 1036340976 8:7915440-7915462 CTCCAAGGCACCCGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036340967 Original CRISPR CAGGCACATCTCGACTGGGA AGG (reversed) Intergenic