ID: 1036340969

View in Genome Browser
Species Human (GRCh38)
Location 8:7915414-7915436
Sequence TTCCCAGTCGAGATGTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036340965_1036340969 -8 Left 1036340965 8:7915399-7915421 CCGTTGCCATCTTCCTTCCCAGT No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data
1036340962_1036340969 3 Left 1036340962 8:7915388-7915410 CCCATCCTGGTCCGTTGCCATCT No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data
1036340960_1036340969 9 Left 1036340960 8:7915382-7915404 CCACCTCCCATCCTGGTCCGTTG No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data
1036340958_1036340969 25 Left 1036340958 8:7915366-7915388 CCTGCTGCTGCTGCTGCCACCTC No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data
1036340961_1036340969 6 Left 1036340961 8:7915385-7915407 CCTCCCATCCTGGTCCGTTGCCA No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data
1036340963_1036340969 2 Left 1036340963 8:7915389-7915411 CCATCCTGGTCCGTTGCCATCTT No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data
1036340964_1036340969 -2 Left 1036340964 8:7915393-7915415 CCTGGTCCGTTGCCATCTTCCTT No data
Right 1036340969 8:7915414-7915436 TTCCCAGTCGAGATGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036340969 Original CRISPR TTCCCAGTCGAGATGTGCCT GGG Intergenic