ID: 1036340972

View in Genome Browser
Species Human (GRCh38)
Location 8:7915425-7915447
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036340965_1036340972 3 Left 1036340965 8:7915399-7915421 CCGTTGCCATCTTCCTTCCCAGT No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340964_1036340972 9 Left 1036340964 8:7915393-7915415 CCTGGTCCGTTGCCATCTTCCTT No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340967_1036340972 -10 Left 1036340967 8:7915412-7915434 CCTTCCCAGTCGAGATGTGCCTG No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340966_1036340972 -3 Left 1036340966 8:7915405-7915427 CCATCTTCCTTCCCAGTCGAGAT No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340963_1036340972 13 Left 1036340963 8:7915389-7915411 CCATCCTGGTCCGTTGCCATCTT No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340962_1036340972 14 Left 1036340962 8:7915388-7915410 CCCATCCTGGTCCGTTGCCATCT No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340961_1036340972 17 Left 1036340961 8:7915385-7915407 CCTCCCATCCTGGTCCGTTGCCA No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data
1036340960_1036340972 20 Left 1036340960 8:7915382-7915404 CCACCTCCCATCCTGGTCCGTTG No data
Right 1036340972 8:7915425-7915447 GATGTGCCTGGGCCGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036340972 Original CRISPR GATGTGCCTGGGCCGCTCCA AGG Intergenic