ID: 1036340975

View in Genome Browser
Species Human (GRCh38)
Location 8:7915439-7915461
Sequence GCTCCAAGGCACCCGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036340966_1036340975 11 Left 1036340966 8:7915405-7915427 CCATCTTCCTTCCCAGTCGAGAT No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340965_1036340975 17 Left 1036340965 8:7915399-7915421 CCGTTGCCATCTTCCTTCCCAGT No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340963_1036340975 27 Left 1036340963 8:7915389-7915411 CCATCCTGGTCCGTTGCCATCTT No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340970_1036340975 0 Left 1036340970 8:7915416-7915438 CCCAGTCGAGATGTGCCTGGGCC No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340964_1036340975 23 Left 1036340964 8:7915393-7915415 CCTGGTCCGTTGCCATCTTCCTT No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340967_1036340975 4 Left 1036340967 8:7915412-7915434 CCTTCCCAGTCGAGATGTGCCTG No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340962_1036340975 28 Left 1036340962 8:7915388-7915410 CCCATCCTGGTCCGTTGCCATCT No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data
1036340971_1036340975 -1 Left 1036340971 8:7915417-7915439 CCAGTCGAGATGTGCCTGGGCCG No data
Right 1036340975 8:7915439-7915461 GCTCCAAGGCACCCGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036340975 Original CRISPR GCTCCAAGGCACCCGTGCTC AGG Intergenic