ID: 1036342889

View in Genome Browser
Species Human (GRCh38)
Location 8:7932179-7932201
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 6, 1: 0, 2: 4, 3: 23, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036342886_1036342889 -8 Left 1036342886 8:7932164-7932186 CCTTGGCTAGGATTGCAGTGTCC 0: 5
1: 1
2: 0
3: 8
4: 148
Right 1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG 0: 6
1: 0
2: 4
3: 23
4: 244
1036342885_1036342889 -7 Left 1036342885 8:7932163-7932185 CCCTTGGCTAGGATTGCAGTGTC 0: 5
1: 1
2: 0
3: 8
4: 114
Right 1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG 0: 6
1: 0
2: 4
3: 23
4: 244
1036342882_1036342889 15 Left 1036342882 8:7932141-7932163 CCTGCAAGGGCTGAGAGACTGTC 0: 1
1: 3
2: 4
3: 9
4: 166
Right 1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG 0: 6
1: 0
2: 4
3: 23
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900510201 1:3055466-3055488 CATTCCCAACAGTGGGAATACGG + Intergenic
903240338 1:21978475-21978497 CAGAGCCCACGGTGGGAATGAGG - Intronic
903244085 1:22003109-22003131 CAGAGCCCACGGTGGGAATGAGG - Intronic
904495579 1:30884562-30884584 CAGGTGCCACAGTGGGAAAAAGG - Intronic
904507491 1:30970322-30970344 CACTGTCCACACTGGCAAGAAGG + Intronic
906013258 1:42549713-42549735 CATTGTACACAGTAGGAGTAGGG - Intronic
908117238 1:60952306-60952328 CAGTGTGCACACTGTAAATATGG - Intronic
911436253 1:97862601-97862623 CAGTGTGCACAGTGTAGATAAGG - Intronic
911559387 1:99385340-99385362 AGGAGTCCACAGAGGGAATATGG - Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
914958374 1:152184815-152184837 CTGTCTCCTCAGTGGCAATACGG - Intergenic
917271019 1:173274517-173274539 GTGTGTACACAGTGGGAAGAGGG - Intergenic
920803944 1:209215931-209215953 AGGAGTTCACAGTGGGAATATGG - Intergenic
921047634 1:211488805-211488827 CAGACTCCACGGAGGGAATATGG - Intronic
921286897 1:213616976-213616998 CAGTGTCCTCATTGGTAAGAAGG + Intergenic
923647930 1:235843169-235843191 CAGTGGCCACAGTGATAAGAAGG + Intronic
923874261 1:238030276-238030298 GGGTGTCCACAGTGGCAACAAGG - Intergenic
1064953367 10:20879589-20879611 CACTCTGCACAGTGGGACTATGG + Intronic
1065341728 10:24713093-24713115 CAGTCTCCACATTGTGAGTAAGG + Intronic
1067226034 10:44376293-44376315 CCTTGTCCCCAGTGGGAATCAGG - Intronic
1069074305 10:64021765-64021787 CAGTGACCACACTGTGACTATGG - Intergenic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1071382472 10:85081787-85081809 AAGTGTGCACAGTGGAGATACGG + Intergenic
1072440535 10:95450373-95450395 CAGTCCCCACAGTGGGTATGTGG - Intronic
1076483658 10:130801827-130801849 CCGTGTCCAGAGTGAGAAAAGGG + Intergenic
1076753626 10:132556295-132556317 CAGTGTCCACTGTGGGTCTGTGG - Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1079467464 11:20744787-20744809 TTCTGTCCACAGTGGGAGTAGGG + Intronic
1079904223 11:26224543-26224565 CAGTGTGCACACAGGGCATAAGG - Intergenic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1083766435 11:64843651-64843673 CAGTGCCCACAGTGGGTTCAGGG + Intronic
1084699770 11:70778896-70778918 CAGTGGCCACTGTGGGCAGAGGG - Intronic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1086184591 11:83998588-83998610 AGGAGTCCACAGTGGGAATGTGG - Intronic
1086430296 11:86730874-86730896 CAGTTTCCACATTGAAAATAGGG + Intergenic
1086606607 11:88703435-88703457 CTGTGATCACAGTGGGACTATGG + Intronic
1088819664 11:113446591-113446613 CTGTTTCCACAGTGGCAATGAGG + Intronic
1088989808 11:114942957-114942979 CAGTGGCCACAGTGGGGACCCGG - Intergenic
1090111311 11:123911801-123911823 TGGTGTGCACAGTGGGAGTAAGG - Intergenic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1091349407 11:134881050-134881072 GTCTGTCCACAGTGGGAATTGGG - Intergenic
1092313278 12:7382562-7382584 AAGGGCCCACAGTGGGAATGTGG - Intronic
1095550156 12:43427321-43427343 CCTTGTCCACAGTGGAACTACGG - Exonic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1098703859 12:73663143-73663165 TAGTGTCCACAGGGGAAAAAAGG + Intergenic
1100776316 12:97979025-97979047 AAGAGTCCATGGTGGGAATATGG - Intergenic
1101786608 12:107889517-107889539 GAGTGTCCAATGTGGGCATATGG + Intergenic
1103122168 12:118389372-118389394 CAGTCTCCACAGTGGCAGGATGG - Intronic
1104983670 12:132585100-132585122 CAGGGTCCACCGTGGAAATGTGG - Exonic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1110500844 13:76226112-76226134 GTGTGTGCACAGTGGGAACAAGG - Intergenic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113361697 13:109637593-109637615 CACTCTCCACAGTGGGCAAAAGG + Intergenic
1113892474 13:113743670-113743692 CAGTGTCCACTGTGGGGCTCAGG - Intergenic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1116764498 14:49053597-49053619 ATGTATACACAGTGGGAATATGG - Intergenic
1117513046 14:56471945-56471967 CAGAGTTCACTGTGGGAATGTGG + Intergenic
1117745092 14:58861042-58861064 AGGAGTCCACAGTGGGAATGTGG + Intergenic
1117869665 14:60186949-60186971 CTGTTTCCCCAGTGGGAATGCGG - Intergenic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1119848394 14:77847659-77847681 CACTGGCCACAGTGGGAAAAGGG - Intronic
1120070383 14:80096267-80096289 TAGTGTCCACAGTGATAATCTGG + Intergenic
1120715509 14:87837014-87837036 CTGCTTTCACAGTGGGAATAAGG - Intergenic
1121754917 14:96394200-96394222 CAGGTTCCAAAGTAGGAATAGGG + Intronic
1122005292 14:98698510-98698532 CAGCGGCCACACTGGGAATGGGG - Intergenic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124181788 15:27482888-27482910 GAGTGGCCACAGTGAGAAGATGG - Intronic
1124374536 15:29121909-29121931 CACTGGCCACAGTGGCATTAGGG + Exonic
1126902964 15:53332932-53332954 GAGTGTTCACAGTGAGAATGGGG + Intergenic
1128524304 15:68402085-68402107 CAGGGGCCAGAGTGGGAAGAGGG + Intronic
1130009856 15:80142624-80142646 CAGAGTGCAGAGTGGGAATCAGG + Intergenic
1131442298 15:92468145-92468167 CAGTGTGCACAGAGGTAATCTGG - Exonic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1135975245 16:27104451-27104473 CAGGCTCCACAGAGGGAATGAGG - Intergenic
1136086717 16:27890501-27890523 CTGTGGCCACAGTGGGAATGAGG + Intronic
1137308879 16:47233484-47233506 CAGTCTTCACAGTGAGAATCTGG - Intronic
1137943621 16:52713338-52713360 CAATGTCCAAAGTGGGATGATGG - Intergenic
1138350807 16:56345360-56345382 CAGTGTCCAGAGTGGGGGCAGGG - Exonic
1138388212 16:56651172-56651194 CATTGTCCAGATTAGGAATATGG + Intronic
1138390841 16:56668976-56668998 CATTGTCCAGATTAGGAATACGG - Intronic
1139063575 16:63286188-63286210 AAGTTTTCACATTGGGAATATGG - Intergenic
1139160971 16:64508075-64508097 AGGAGTCCACAGTGGGAATGTGG + Intergenic
1139446263 16:67000567-67000589 CAGGGTCCGCAGTGAGAAGACGG - Intronic
1142910251 17:3083217-3083239 CAGTTTCTACAGTGGGAAAAGGG - Intergenic
1143672441 17:8405878-8405900 CAGTCTCCACAGTGAGACCAGGG + Intergenic
1143730562 17:8880513-8880535 CAGGACCCACAGTGGGACTATGG + Exonic
1146551702 17:33785994-33786016 CAGTTTCCACACTGGGAGAATGG - Intronic
1146558671 17:33849389-33849411 CAGTCTCCACAGTTGCAACATGG - Intronic
1150668951 17:67172504-67172526 AAGTGGCTAAAGTGGGAATATGG - Intronic
1153752292 18:8245132-8245154 CACTGACCACAGTGGGTATTAGG - Intronic
1156037259 18:32778930-32778952 CAATGTCCCCAGCGGGAAAAGGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1159912040 18:74154708-74154730 CTGTGTTCAGAGTAGGAATATGG - Intronic
1160966487 19:1749058-1749080 CAGTTTGCACTGTGGGAAAATGG - Intergenic
1161154731 19:2726761-2726783 CAGTGTCCACAGTGCCCACAGGG + Intronic
1161265824 19:3363882-3363904 CAGTGTCCACAGTGCCAAGGGGG + Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1163279019 19:16303844-16303866 AAGTGTCCACATTGGGAAACTGG + Intergenic
1163375935 19:16930625-16930647 TAGAGTCCACGGTGGGAATGGGG - Intronic
1163979123 19:20882064-20882086 CAGTCACCACAGTGGGAACCAGG + Intergenic
1164230755 19:23285716-23285738 CAGAGTGCAGAGTGGGAATCAGG - Intergenic
1164837770 19:31369014-31369036 CACTGTCCACAGTGGCTATCAGG - Intergenic
1164902182 19:31937807-31937829 CTGTGTCCACACTGGAAATCAGG - Intergenic
1165838055 19:38771221-38771243 CAGTTTCCTCACTGGGAAAATGG + Intronic
1165841510 19:38791476-38791498 CAGTTTCCTCACTGGGAAAATGG - Intronic
1166187009 19:41146797-41146819 CAGTTTCCCCAGTGGTAAAATGG - Intergenic
1167464205 19:49641700-49641722 CAGTCTCCCGAGTGGGACTACGG + Intergenic
1167496728 19:49823803-49823825 CTGTGTCCACAGTGTCACTAGGG - Intronic
925880688 2:8349941-8349963 GATTATCCACAGTGGGAATAAGG + Intergenic
927303704 2:21545576-21545598 CACTGTCCATTGGGGGAATAAGG + Intergenic
927571969 2:24167762-24167784 CAGAGTCCACAGTGGGAGGGAGG + Intronic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
928815755 2:35292821-35292843 CAGTGGCCCCAGTGGGGATTGGG + Intergenic
935066123 2:99650108-99650130 AAGTTTCCACAGTTGGAATATGG + Intronic
936105021 2:109615599-109615621 CAGGGACTACAGTGGGAAAAAGG + Exonic
936316581 2:111429447-111429469 CAGAGTCCACAGTGGGCAGTTGG + Intergenic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
939182779 2:138823688-138823710 CAGTTTCTACAGTGGGAAAGGGG + Intergenic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
939706175 2:145456705-145456727 CAGTGACCTAAGTGGAAATATGG + Intergenic
939755913 2:146110327-146110349 CAGTCTCCAGAGTGGAAGTAAGG - Intergenic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
942705539 2:178767569-178767591 CAGTTTCCACTCAGGGAATAAGG - Intronic
943637237 2:190319651-190319673 CACTCGCCACAGTGGGAAAAGGG - Intronic
944510028 2:200455614-200455636 CAGCTTCCACAGTAGGAATGTGG + Intronic
945803480 2:214462274-214462296 AAGAGTCCACAGTGGGAATGTGG + Intronic
946223471 2:218248875-218248897 CTGTTTTCACAGTGAGAATATGG + Intronic
947824534 2:233095841-233095863 AACTGTCAACAGTGGGACTAGGG - Intronic
1171083525 20:22213649-22213671 CAGTGTCCACATTTGTAAAATGG - Intergenic
1172973154 20:38888161-38888183 TAGTGTCCACGGTGGGGATTAGG + Intronic
1173020276 20:39261394-39261416 CAGTGTGCAGAGTGGAAAGAAGG - Intergenic
1173653195 20:44680691-44680713 GTGTTTCCACACTGGGAATAGGG - Intergenic
1174220863 20:48954111-48954133 CAGTGTCCACAGGAGGACAAGGG + Intronic
1174759953 20:53197537-53197559 CATTTCCCACAGTGTGAATACGG - Intronic
1176046724 20:63096777-63096799 GAGTGGCCACAGTGGGGATGGGG + Intergenic
1177938769 21:27382781-27382803 CAGAGTCCAAAGTGGGATTTTGG - Intergenic
1179615249 21:42579376-42579398 AAATGTCCACAGTGGGAAAAAGG - Intronic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1180871255 22:19148598-19148620 CAATGTCCACATTGAGAAGAGGG + Exonic
1181462873 22:23095624-23095646 CAGTGTCCCCTGTGGCAAGAGGG + Exonic
1181952426 22:26564102-26564124 CAGTCTCCATAGTTGGAAAATGG - Intronic
1182287691 22:29258037-29258059 CAGTGCCCTCAGTGGGAACCTGG + Intronic
1183122561 22:35741550-35741572 CAGTGTCAACACTGAGAATTGGG - Intronic
1183539162 22:38419601-38419623 CAGTGCCCACAGTGAGAAGGAGG - Intergenic
1184420748 22:44381595-44381617 CAGTGTCCTCAGTGGTAAAATGG + Intergenic
1184596216 22:45515796-45515818 CAGCTTCCCCAGTGGGAAAACGG - Intronic
950030260 3:9847328-9847350 ATGTGACCACAGTGGGAAGATGG + Intronic
950097572 3:10338868-10338890 CAGTGACCTCAGGAGGAATAAGG - Intronic
951219816 3:20057201-20057223 CAGTGCCAACAAAGGGAATAGGG + Intronic
951913258 3:27773377-27773399 CAGTGTCCACTGTGGGAAACTGG - Intergenic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953280164 3:41547488-41547510 AAGGGTCCACAGTGGGAATGTGG - Intronic
955393069 3:58535291-58535313 CAGTGTCCACAGGGGGAGTGGGG - Intronic
955989898 3:64615334-64615356 CCTTGTCCACAGTGGAAATCTGG - Exonic
956325347 3:68046100-68046122 AAGTATCCTCAGTGGGAATATGG - Intronic
956889917 3:73602555-73602577 CTGTGTCAAGAGTGGCAATAGGG + Intronic
960989757 3:123302876-123302898 CAGTGTCTGCACTGGGAACAAGG - Intronic
962426892 3:135278075-135278097 CAGTTTCCACATAAGGAATAGGG + Intergenic
966323888 3:178732843-178732865 CAGTGTTCACAGTGGATTTATGG + Intronic
966511357 3:180766753-180766775 CAGAGTGCAGAGTGGGAATCAGG - Intronic
966619455 3:181947790-181947812 CATTGTTCACAGTGTGAACAGGG - Intergenic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
967815300 3:193793120-193793142 CAGTTTCCTCAGTGGGGAAATGG + Intergenic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
970055401 4:11965539-11965561 AAGTGTCCACAGTGGCTATGGGG + Intergenic
971048339 4:22831251-22831273 AGGTGTCCACAGTGGCAATGGGG - Intergenic
971163915 4:24162435-24162457 CAAGGCCCACTGTGGGAATATGG - Intergenic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
971363500 4:25957784-25957806 CAGTGTCTACTGAGTGAATATGG - Intergenic
972023695 4:34349633-34349655 CAGTTTCCTCACTGGTAATATGG + Intergenic
972043118 4:34629142-34629164 CAATGTCACCTGTGGGAATATGG - Intergenic
973710117 4:53621525-53621547 CAGTGTCCACACTGGGTATTTGG - Intronic
976271241 4:83232377-83232399 CAGGGGACACAGTGAGAATAAGG - Intergenic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
979380485 4:120000300-120000322 GATTGTCCACAGTGGGATTAGGG - Intergenic
980397417 4:132232507-132232529 CATGGTCCACCATGGGAATAAGG - Intergenic
981037391 4:140186835-140186857 CTGTGTCATCAGTGGGTATATGG + Intergenic
981625158 4:146747096-146747118 AAGTGTCCACGGTGGTGATAGGG - Intronic
981923905 4:150117121-150117143 CAGTGGCCCCAGTGGGGATCAGG + Intronic
981998462 4:151000951-151000973 AGGAGTCCACAGTGGGAATGTGG - Intronic
983779490 4:171650765-171650787 AAGAGTTCACAGTGGGAATGTGG - Intergenic
985250418 4:188018648-188018670 CAATGTCCACACTGTGAAAACGG - Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985913301 5:2899193-2899215 CTGGGTCCACGGTGGGAAAATGG - Intergenic
986501413 5:8403830-8403852 CAGTGTCCACATTGGTAAACTGG + Intergenic
987647199 5:20689368-20689390 CCCTGTCAACAGTGGGAACATGG + Intergenic
987984309 5:25126077-25126099 CAGTGTCCTCATTGCGATTAGGG + Intergenic
988213815 5:28245205-28245227 CAGTGTATACAGAGGTAATAGGG - Intergenic
991525896 5:67557409-67557431 CAGTTTTCTCAGTGGCAATAGGG + Intergenic
993431878 5:87841830-87841852 CAGAGTCCATGGTGGGAATGTGG + Intergenic
994236163 5:97365551-97365573 CTGTGTTCAGAGTGGGAACAGGG + Intergenic
995853167 5:116568152-116568174 CAGGGTCCAGAGTGGGAAAGAGG + Intronic
996165872 5:120222363-120222385 TTGTGTCCACAGAGGGATTATGG + Intergenic
997089997 5:130845557-130845579 CAGGGTCCACAATGTGAATAAGG + Intergenic
997832120 5:137158908-137158930 CAGGCTCCACAGGGGAAATATGG + Intronic
998563375 5:143193143-143193165 CAGTGTCCACAGTGTGGCAAAGG - Intronic
999716189 5:154362165-154362187 CAGTGTCCATTGTTGGAATGAGG - Intronic
1001601170 5:172929491-172929513 CAGTGTCTCCAGTGGGCATTTGG + Intronic
1002135240 5:177103730-177103752 CAGTGTCCACATCTGGAAAATGG - Intergenic
1002692192 5:181058223-181058245 CAGTTGTCACAGTGGGAATGGGG + Intronic
1003563807 6:7205356-7205378 CAGTTTCCACACTGGTAAAATGG - Intronic
1003644645 6:7904712-7904734 CAGTGTCCACACCTGGAACAAGG + Exonic
1006746980 6:36349794-36349816 CAGTGTCCACAGTGAGCGTGAGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1018827424 6:167420422-167420444 CAGTGTCCACCGGGGGTAAATGG - Intergenic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1018908003 6:168086347-168086369 CAGTGTCCACACTGGGCACATGG - Intergenic
1018908042 6:168086561-168086583 CAGTGTCCACACTGGGCACGTGG - Intergenic
1018908061 6:168086650-168086672 CCATGTCCACAGTGGGAACATGG - Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1029705532 7:102273886-102273908 TAGAGTCCACAGTGGGACTCCGG + Intronic
1030020558 7:105271311-105271333 CAGTGTCACCAGTCAGAATATGG - Intronic
1030468128 7:109928281-109928303 CAAATTTCACAGTGGGAATATGG + Intergenic
1030571644 7:111233063-111233085 CAGTGTTTTCACTGGGAATATGG - Intronic
1031744981 7:125484354-125484376 CAGTGTCCAAAGTCAGCATAGGG + Intergenic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1034151512 7:148920106-148920128 CACTATCTACAGTGGGACTAGGG - Intergenic
1034855212 7:154539184-154539206 CAGGGCCCACAGTGGGGAGAAGG - Intronic
1036179010 8:6567395-6567417 CAGTGACCACCGTGTGAACAGGG + Intronic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1038187771 8:25291259-25291281 CAGTTTCCACAGTTGCAAGAGGG + Intronic
1040547094 8:48407204-48407226 CAGTGTCCACACTGGGAGTAGGG - Intergenic
1040899509 8:52403462-52403484 TGGTGTCCACAATGGTAATAGGG + Intronic
1042260186 8:66850577-66850599 CAGTTTCCTCAGTGGTAAAATGG - Intronic
1043649876 8:82578348-82578370 GGGAGTCCACAGTGAGAATATGG - Intergenic
1043874148 8:85465091-85465113 CAGTTTCCACATTTGTAATATGG - Intronic
1045371365 8:101527072-101527094 AAATGTCAACAGAGGGAATAAGG + Intronic
1045809736 8:106207321-106207343 AAGTGGCCAAAGTGGGAACATGG - Intergenic
1048994114 8:139780128-139780150 CAATGTCCACGGTTGGATTATGG - Intronic
1049353893 8:142178344-142178366 CACTGGCCACAGTGGGACTCAGG - Intergenic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1052021183 9:23527342-23527364 CAGTTTCCACACTTGGAAAAGGG - Intergenic
1055802716 9:80057929-80057951 CAGTGTCCTCACTAGGAAGAAGG + Intergenic
1056737678 9:89223792-89223814 CTGTGTCCACAGTGTGCATTTGG - Intergenic
1058715619 9:107719696-107719718 CAGTGACCACAGTGGGCTTGGGG - Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1060160739 9:121360928-121360950 CAGTGTATACACTGGGAAAATGG + Intronic
1060219638 9:121757550-121757572 CATTGTTCACAGTGGGAAACAGG - Intronic
1060477312 9:123996585-123996607 CAGGGTCCCCAGGGGGGATAAGG - Intergenic
1061056157 9:128224099-128224121 CAGTGTCCCCAGTTGTAAAATGG - Intronic
1061060366 9:128247203-128247225 CAGTTTCCTCACTGGGAAGATGG - Intronic
1061135159 9:128729558-128729580 CTGTGTCCTCAGTGGGCACAGGG + Intergenic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061631582 9:131875447-131875469 CCGTGTCCACTGTGGAGATATGG + Intronic
1062399992 9:136368190-136368212 CAGTGTCCGCAGTGAGGACAGGG - Intronic
1187005038 X:15224469-15224491 CAGTGTCCACAGAGGGACTGTGG + Intergenic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1188666777 X:32832841-32832863 CCAGGTCCACAGTGGCAATATGG - Intronic
1188836819 X:34967782-34967804 CAGTGTCCATAGTGAGCATGTGG - Intergenic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1190629239 X:52368918-52368940 CAGAGTCCTCAGTGGGAACCAGG + Intergenic
1190751513 X:53366067-53366089 CAGTTTCCATAGTGGGAAATAGG + Intergenic
1193781337 X:85705419-85705441 CAGTGTCCATAGTGTTCATAAGG - Intergenic
1193917910 X:87388597-87388619 CAGTTTCCACAGGGGCAATGTGG + Intergenic
1194689339 X:96963567-96963589 CAGAGTTCACAGTGGGAATCTGG + Intronic
1195578425 X:106475535-106475557 CAGTCTCCAAAGAGTGAATAAGG + Intergenic
1198038720 X:132827483-132827505 ATGTGTCAACAGTGGGAAAAGGG + Intronic
1198759074 X:140012166-140012188 AAGTGTCCACAGTGGTCATGGGG + Intergenic
1198779670 X:140221406-140221428 AAGTGTCCACAGTGGTCATGGGG - Intergenic
1199451190 X:147980909-147980931 CAGTGTGCACTCTGGGAATGAGG + Intergenic
1202169813 Y:22031524-22031546 TAGTGTGCACAGTGAGAATCAGG - Intergenic
1202221553 Y:22554849-22554871 TAGTGTGCACAGTGAGAATCAGG + Intergenic
1202321566 Y:23640823-23640845 TAGTGTGCACAGTGAGAATCAGG - Intergenic
1202549201 Y:26029233-26029255 TAGTGTGCACAGTGAGAATCAGG + Intergenic