ID: 1036344882

View in Genome Browser
Species Human (GRCh38)
Location 8:7954947-7954969
Sequence CGTCCTGTGCTGCCACCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036344879_1036344882 -6 Left 1036344879 8:7954930-7954952 CCACCGCTAAGACCAAACGTCCT No data
Right 1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG No data
1036344877_1036344882 22 Left 1036344877 8:7954902-7954924 CCTGAATTTCAGTGATTCAGACT No data
Right 1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG No data
1036344876_1036344882 27 Left 1036344876 8:7954897-7954919 CCACACCTGAATTTCAGTGATTC No data
Right 1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG No data
1036344880_1036344882 -9 Left 1036344880 8:7954933-7954955 CCGCTAAGACCAAACGTCCTGTG No data
Right 1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036344882 Original CRISPR CGTCCTGTGCTGCCACCTCA TGG Intergenic
No off target data available for this crispr