ID: 1036346748

View in Genome Browser
Species Human (GRCh38)
Location 8:7970963-7970985
Sequence CCACTGGCACGGAAGTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036346748_1036346755 9 Left 1036346748 8:7970963-7970985 CCAAATGACTTCCGTGCCAGTGG No data
Right 1036346755 8:7970995-7971017 CCGTTTCCACGCAATGGAAGTGG No data
1036346748_1036346753 3 Left 1036346748 8:7970963-7970985 CCAAATGACTTCCGTGCCAGTGG No data
Right 1036346753 8:7970989-7971011 AATTTTCCGTTTCCACGCAATGG No data
1036346748_1036346757 24 Left 1036346748 8:7970963-7970985 CCAAATGACTTCCGTGCCAGTGG No data
Right 1036346757 8:7971010-7971032 GGAAGTGGACACCGTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036346748 Original CRISPR CCACTGGCACGGAAGTCATT TGG (reversed) Intergenic