ID: 1036346751

View in Genome Browser
Species Human (GRCh38)
Location 8:7970974-7970996
Sequence GGAAAATTTTCCCACTGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036346751_1036346753 -8 Left 1036346751 8:7970974-7970996 CCGTGCCAGTGGGAAAATTTTCC No data
Right 1036346753 8:7970989-7971011 AATTTTCCGTTTCCACGCAATGG No data
1036346751_1036346758 21 Left 1036346751 8:7970974-7970996 CCGTGCCAGTGGGAAAATTTTCC No data
Right 1036346758 8:7971018-7971040 ACACCGTGAAACAGGTAAGTCGG No data
1036346751_1036346757 13 Left 1036346751 8:7970974-7970996 CCGTGCCAGTGGGAAAATTTTCC No data
Right 1036346757 8:7971010-7971032 GGAAGTGGACACCGTGAAACAGG No data
1036346751_1036346755 -2 Left 1036346751 8:7970974-7970996 CCGTGCCAGTGGGAAAATTTTCC No data
Right 1036346755 8:7970995-7971017 CCGTTTCCACGCAATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036346751 Original CRISPR GGAAAATTTTCCCACTGGCA CGG (reversed) Intergenic