ID: 1036346752

View in Genome Browser
Species Human (GRCh38)
Location 8:7970979-7971001
Sequence GAAACGGAAAATTTTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036346752_1036346755 -7 Left 1036346752 8:7970979-7971001 CCAGTGGGAAAATTTTCCGTTTC No data
Right 1036346755 8:7970995-7971017 CCGTTTCCACGCAATGGAAGTGG No data
1036346752_1036346757 8 Left 1036346752 8:7970979-7971001 CCAGTGGGAAAATTTTCCGTTTC No data
Right 1036346757 8:7971010-7971032 GGAAGTGGACACCGTGAAACAGG No data
1036346752_1036346758 16 Left 1036346752 8:7970979-7971001 CCAGTGGGAAAATTTTCCGTTTC No data
Right 1036346758 8:7971018-7971040 ACACCGTGAAACAGGTAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036346752 Original CRISPR GAAACGGAAAATTTTCCCAC TGG (reversed) Intergenic