ID: 1036346753

View in Genome Browser
Species Human (GRCh38)
Location 8:7970989-7971011
Sequence AATTTTCCGTTTCCACGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036346748_1036346753 3 Left 1036346748 8:7970963-7970985 CCAAATGACTTCCGTGCCAGTGG No data
Right 1036346753 8:7970989-7971011 AATTTTCCGTTTCCACGCAATGG No data
1036346747_1036346753 28 Left 1036346747 8:7970938-7970960 CCTTTAGTATCAATGAGAATTAG No data
Right 1036346753 8:7970989-7971011 AATTTTCCGTTTCCACGCAATGG No data
1036346751_1036346753 -8 Left 1036346751 8:7970974-7970996 CCGTGCCAGTGGGAAAATTTTCC No data
Right 1036346753 8:7970989-7971011 AATTTTCCGTTTCCACGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036346753 Original CRISPR AATTTTCCGTTTCCACGCAA TGG Intergenic