ID: 1036346755

View in Genome Browser
Species Human (GRCh38)
Location 8:7970995-7971017
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036346751_1036346755 -2 Left 1036346751 8:7970974-7970996 CCGTGCCAGTGGGAAAATTTTCC No data
Right 1036346755 8:7970995-7971017 CCGTTTCCACGCAATGGAAGTGG No data
1036346752_1036346755 -7 Left 1036346752 8:7970979-7971001 CCAGTGGGAAAATTTTCCGTTTC No data
Right 1036346755 8:7970995-7971017 CCGTTTCCACGCAATGGAAGTGG No data
1036346748_1036346755 9 Left 1036346748 8:7970963-7970985 CCAAATGACTTCCGTGCCAGTGG No data
Right 1036346755 8:7970995-7971017 CCGTTTCCACGCAATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036346755 Original CRISPR CCGTTTCCACGCAATGGAAG TGG Intergenic