ID: 1036355231

View in Genome Browser
Species Human (GRCh38)
Location 8:8037657-8037679
Sequence TACCCACAGTCCTCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036355231_1036355237 30 Left 1036355231 8:8037657-8037679 CCGCACCTGGAGGACTGTGGGTA No data
Right 1036355237 8:8037710-8037732 CCGACAGCAGGTACGTTACTTGG No data
1036355231_1036355235 18 Left 1036355231 8:8037657-8037679 CCGCACCTGGAGGACTGTGGGTA No data
Right 1036355235 8:8037698-8037720 AGCTCAGATCTGCCGACAGCAGG 0: 27
1: 52
2: 35
3: 43
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036355231 Original CRISPR TACCCACAGTCCTCCAGGTG CGG (reversed) Intergenic
No off target data available for this crispr