ID: 1036355235

View in Genome Browser
Species Human (GRCh38)
Location 8:8037698-8037720
Sequence AGCTCAGATCTGCCGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 27, 1: 52, 2: 35, 3: 43, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036355227_1036355235 25 Left 1036355227 8:8037650-8037672 CCCTACACCGCACCTGGAGGACT No data
Right 1036355235 8:8037698-8037720 AGCTCAGATCTGCCGACAGCAGG 0: 27
1: 52
2: 35
3: 43
4: 215
1036355231_1036355235 18 Left 1036355231 8:8037657-8037679 CCGCACCTGGAGGACTGTGGGTA No data
Right 1036355235 8:8037698-8037720 AGCTCAGATCTGCCGACAGCAGG 0: 27
1: 52
2: 35
3: 43
4: 215
1036355232_1036355235 13 Left 1036355232 8:8037662-8037684 CCTGGAGGACTGTGGGTAGAAGG No data
Right 1036355235 8:8037698-8037720 AGCTCAGATCTGCCGACAGCAGG 0: 27
1: 52
2: 35
3: 43
4: 215
1036355228_1036355235 24 Left 1036355228 8:8037651-8037673 CCTACACCGCACCTGGAGGACTG No data
Right 1036355235 8:8037698-8037720 AGCTCAGATCTGCCGACAGCAGG 0: 27
1: 52
2: 35
3: 43
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036355235 Original CRISPR AGCTCAGATCTGCCGACAGC AGG Intergenic
900572613 1:3366143-3366165 CGCCCCGATGTGCCGACAGCCGG + Intronic
900804327 1:4757331-4757353 AGCCCAGATCAGCGAACAGCTGG - Intronic
902986481 1:20157419-20157441 AGCTCAGATATGTCAACAGGAGG + Intergenic
905125134 1:35710871-35710893 AGCTCAGATCTGCCTATGGGAGG + Intergenic
905283506 1:36864363-36864385 AGCTGAGCTCTGCCTACAGGGGG + Intronic
907505379 1:54914401-54914423 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
907638327 1:56158934-56158956 AGCTAAGATCTGAAGATAGCAGG + Intergenic
907686635 1:56618235-56618257 AGCTGAGATCTTCCAAAAGCAGG + Intronic
911912312 1:103652328-103652350 AGCTCAGATCTGCAGACAGCAGG - Intergenic
911916142 1:103699620-103699642 AGCTCAGATCTGCAGACAGCAGG + Intronic
911919727 1:103746466-103746488 AGCTCAGATCTGCAGACAGCAGG - Intronic
911973509 1:104464759-104464781 AGCTCAGATCTGCAGACAGCAGG - Intergenic
913468805 1:119170470-119170492 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
918647350 1:186919384-186919406 AGCTCATATCTGCAGACAGCAGG - Intronic
921747093 1:218751673-218751695 AGCTCAGATCTGCAGACAGCAGG - Intergenic
922684476 1:227628633-227628655 GGCTCAGCTCTGCTTACAGCAGG - Intronic
922786682 1:228286379-228286401 TGCTCAGAGCTGCAGACAGGTGG + Intronic
1064395695 10:14980523-14980545 AGCTCAGATCTCCTGACAGCAGG - Intronic
1064397386 10:14992708-14992730 AGCTCAGATCTGCCGACAGCAGG - Intergenic
1064400271 10:15015167-15015189 AGCTCAGATCTGCTGACAGCAGG - Intergenic
1064726481 10:18285039-18285061 AGCACAGAACTGCTGACTGCTGG - Intronic
1065199352 10:23298725-23298747 AGCTCAGCTCTGCTCACAGCAGG - Intronic
1065232109 10:23608993-23609015 AGCTCAGCTCTTCCTTCAGCAGG + Intergenic
1065241624 10:23711066-23711088 AGCTCAGATGTGCATACAGAAGG + Intronic
1066390263 10:34972511-34972533 AGCTCAGATCTCCCGACAGCAGG + Intergenic
1071282081 10:84112180-84112202 AACTCAGATCTGCAGACAGCAGG + Intergenic
1072377885 10:94836733-94836755 GGCTCAGCTCTGCTCACAGCAGG - Intronic
1072471705 10:95719585-95719607 GGCTCAGCTCTGCTCACAGCAGG - Intronic
1072555945 10:96513730-96513752 AGCTCAGCTCGGCCGAAAGACGG + Exonic
1077589178 11:3478564-3478586 AGCTTAGATCTGACGACAGCAGG - Intergenic
1078315135 11:10288561-10288583 TGCTGAGAGCTGCAGACAGCAGG - Intronic
1079601100 11:22314298-22314320 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1081966443 11:47173050-47173072 AGCTCTGAGCTGCCGAAGGCTGG - Intronic
1082099389 11:48159505-48159527 AAATCAGATCTGCCTACAACAGG - Intronic
1083149325 11:60782060-60782082 AACTCAGCCCTGCCGACACCTGG - Intergenic
1083296553 11:61718434-61718456 AGAACAGAGCTGCCAACAGCTGG - Intronic
1084227872 11:67728684-67728706 AGCTCAGATCTGCCGACAGCAGG - Intergenic
1084244870 11:67850179-67850201 AGCTTAGATCTGCTGACAGCAGG - Intergenic
1084261276 11:67980366-67980388 AGCTCAGATCTGCTGACAGCAGG - Intergenic
1084807356 11:71588181-71588203 AGCTCAGATCTGCCGACAGCAGG + Intronic
1084811375 11:71613730-71613752 AGCTCAGATCTGCCGACAGCAGG + Intergenic
1084827818 11:71744378-71744400 AGCTTAGATCTGCCGACAGCAGG + Intergenic
1084844438 11:71888189-71888211 AGCTCAGATCTGCTGACAGAAGG + Intronic
1084847291 11:71910646-71910668 AGCTCAGATCTGCCGACAGCAGG + Intronic
1085601560 11:77860456-77860478 CGCTCAGCTCTGCTCACAGCAGG - Intronic
1085697302 11:78715906-78715928 AGCTCTGTTCTGCAGACAGGTGG - Intronic
1089047862 11:115519233-115519255 AGCTCAGCTTTGCCCCCAGCAGG - Intergenic
1089403711 11:118180472-118180494 AGCTGTGAGCTGCTGACAGCGGG - Intergenic
1091401702 12:185193-185215 AGCCCAGGTCTCCGGACAGCTGG + Intergenic
1092294276 12:7185752-7185774 GGCTCAGTTCTGCTTACAGCAGG + Intergenic
1092415441 12:8287327-8287349 AGCTTAGATCTGCCGACAGCAGG - Intergenic
1092432552 12:8420935-8420957 AGCTCAGATCTGCTGACAGCAGG - Intergenic
1092469238 12:8763617-8763639 GGCTCAGCTCTGCTCACAGCAGG - Intronic
1092538581 12:9406343-9406365 AGCTCAGATCTTCCAGCAGAAGG + Intergenic
1092538880 12:9407343-9407365 AGCTCAGATCTGCCGACGGCAGG + Intergenic
1092556547 12:9567576-9567598 AGCTCAGATCTGCCGATGGCAGG - Intergenic
1092556859 12:9569145-9569167 AGCTCAGATCTGCCGACGGTAGG - Intergenic
1093289152 12:17300579-17300601 AGCTCAGATCTGCTGACAGCAGG + Intergenic
1094513960 12:31117455-31117477 AGCTCAGATCTGCCCACGGCAGG + Intergenic
1094514417 12:31118932-31118954 AGCTCAGACCTGCCGACCGCAGG + Intergenic
1094515101 12:31121174-31121196 AGCTCAGATCTGCCGACCGCAGG + Intergenic
1094515542 12:31123062-31123084 AGCTCAGATCTACCGATGGCAGG + Intergenic
1094806670 12:34100782-34100804 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1095125519 12:38472247-38472269 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1096509156 12:52117892-52117914 AGCTGAGATCTGTCGACAGCAGG - Intergenic
1098031290 12:66257399-66257421 AGCTCAGCTATGCTGTCAGCTGG - Intergenic
1098748486 12:74268038-74268060 AGCTCAGATCTGCAGACAGCAGG + Intergenic
1099182221 12:79482076-79482098 AGCTAAAGTCTGCTGACAGCTGG - Intergenic
1101029401 12:100644906-100644928 AGCTCAGATCTGCAGACAGCAGG - Intergenic
1102847393 12:116200954-116200976 AGATCAGATCTGGAGAGAGCAGG + Intronic
1103572530 12:121854652-121854674 ATCTCAGTGGTGCCGACAGCAGG + Intronic
1103803318 12:123553703-123553725 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1105982722 13:25535276-25535298 AGCTCAGATCTGCTGTCCCCTGG + Intronic
1106644129 13:31614585-31614607 AGCACAGATCAGCCGGGAGCGGG - Intergenic
1107490668 13:40877665-40877687 AGCTCAGATCTGCAGACAGCAGG - Intergenic
1107829151 13:44358976-44358998 AACTTAGTTCTGCCCACAGCAGG - Intergenic
1107887648 13:44887218-44887240 AGCTCAGATGTGCCGCCTGTAGG + Intergenic
1107940339 13:45377158-45377180 AGCTCAAATCTGCCGACGGCAGG - Intergenic
1107940757 13:45378614-45378636 AGCTCAAATCTGCCAACGGCAGG - Intergenic
1107940884 13:45379278-45379300 AGCTCAAATCTGCCAACGGCAGG - Intergenic
1107941013 13:45379944-45379966 AGCTCAAATCTGCTGACGGCAGG - Intergenic
1107941350 13:45381160-45381182 AGCTCAAATCTGCTGACGGCAGG - Intergenic
1107941949 13:45383178-45383200 AGCTCCAATCTGCCGACGGCAGG - Intergenic
1108053225 13:46464710-46464732 AGCTCAAATCTGCCGAGGGCAGG + Intergenic
1108053527 13:46465878-46465900 AGCTCAAATCTGCCGAGGGCAGG + Intergenic
1108053674 13:46466644-46466666 AGCTCAAATCTGCCGATGGCAGG + Intergenic
1108053948 13:46467708-46467730 AGCTCAAATCTGCCGATGGCAGG + Intergenic
1108876884 13:55058880-55058902 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1109537323 13:63738292-63738314 AGCTCAAATCTGCCCAGGGCAGG - Intergenic
1109537449 13:63738959-63738981 AGCTCAAATCTGCTGACGGCAGG - Intergenic
1109537767 13:63740186-63740208 AGCTCAAATCTGCCGACGGCAGG - Intergenic
1109537894 13:63740853-63740875 AGCTCAAATCTGCCGACGGCTGG - Intergenic
1109545692 13:63838129-63838151 AGCTCAAATCTGCTGACGGCAGG + Intergenic
1109545928 13:63839116-63839138 AGCTCAAATCTGCCGAAGGCAGG + Intergenic
1109546052 13:63839784-63839806 AGCTCAAATCTGCCGACGGCGGG + Intergenic
1109546544 13:63841558-63841580 AGCTCAAATCTGCCGACGGCAGG + Intergenic
1109546791 13:63842616-63842638 AGCTCAAATCTGCCGATGGCAGG + Intergenic
1109546914 13:63843283-63843305 AGCTCAAATCTGCCTAGGGCAGG + Intergenic
1109802857 13:67400921-67400943 AGCTCAGATCTGCAGACAATAGG + Intergenic
1110891678 13:80704823-80704845 AGCTCAAATCTGTCAACGGCAGG + Intergenic
1110892135 13:80706476-80706498 AGCTCAAATCTGCCGATGGCAGG + Intergenic
1113125847 13:106978722-106978744 AGGTCAGTTTTGCAGACAGCAGG - Intergenic
1114384523 14:22241524-22241546 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1114646109 14:24257104-24257126 AGCTCAGATCTGCCAGCGTCTGG + Intronic
1117004745 14:51409183-51409205 AGCACAGATCTGCACACAGAGGG - Intergenic
1117038643 14:51750753-51750775 AGCTCAGATCTGCCGACAGCAGG + Intergenic
1117812771 14:59566148-59566170 AGCTCAGAGTTGGCTACAGCTGG - Intronic
1120938192 14:89919306-89919328 ATCTCAGATCGGCCAAGAGCAGG + Intronic
1122134818 14:99626784-99626806 AGCTCAGGTCTTCTGAAAGCTGG + Intergenic
1122153042 14:99734878-99734900 ACCTCAGTTCAGCCCACAGCCGG + Intergenic
1122322479 14:100863631-100863653 AGCTCAGATGTGCAGAAAGAGGG + Intergenic
1124495976 15:30187360-30187382 AGCTCAGGACTGCCAACAGCGGG + Intergenic
1124747598 15:32351287-32351309 AGCTCAGGACTGCCAACAGCGGG - Intergenic
1127096461 15:55516122-55516144 AGCTCAGATCTGCAGACAGCAGG - Intergenic
1128362405 15:66971683-66971705 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1128549391 15:68588482-68588504 AGCTCTGATCTACAGAGAGCCGG - Intronic
1131420387 15:92300008-92300030 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1133059341 16:3164349-3164371 ACCTCAGAACTGCCGACCTCCGG - Intergenic
1133326324 16:4944523-4944545 AGCCCTGGTCTGCCCACAGCCGG + Intronic
1135286480 16:21197831-21197853 AGATCAGATGAGCCGACACCTGG + Exonic
1135485041 16:22856893-22856915 CGCTCAGATCTGATGACTGCAGG + Intronic
1136083300 16:27867218-27867240 AGCTCAGTTCAGCGCACAGCAGG + Intronic
1138196170 16:55053878-55053900 AGCTCAGACCAGCCCCCAGCTGG - Intergenic
1141235678 16:82213673-82213695 GGCTCATCTCTGCCGACACCTGG + Intergenic
1141506710 16:84482831-84482853 AACCCTGATCTGCCGACACCTGG - Intronic
1141658371 16:85428388-85428410 AGCTCAGCTCTGCCACCTGCTGG + Intergenic
1141658979 16:85431521-85431543 GGATCAGATCTGGGGACAGCAGG - Intergenic
1142382466 16:89740809-89740831 AGGTCAGATGTGACGACAGCAGG + Exonic
1144860976 17:18301811-18301833 AGATCACCTCTGCCGACAGTGGG + Intronic
1147767146 17:42844785-42844807 GGCTCAGGTCTGCAAACAGCTGG - Exonic
1147768339 17:42851514-42851536 GGCTCAGGTCTGCAAACAGCTGG - Exonic
1147770931 17:42867446-42867468 GGCTCAGGTCTGCAAACAGCTGG - Intergenic
1149273876 17:55013585-55013607 GGCTCAGCTCTGCTCACAGCAGG - Intronic
1151560178 17:74865802-74865824 AGCTCAGGTCTGGCTCCAGCTGG + Exonic
1151719684 17:75847992-75848014 AGCTCCCATCTGCAGGCAGCGGG - Intronic
1152922631 17:83073540-83073562 AGCCCAGAGCTGCCCCCAGCTGG - Intergenic
1153401762 18:4689853-4689875 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1154289668 18:13096490-13096512 AGCAGAGATCTGCACACAGCTGG + Intronic
1156798849 18:41083382-41083404 AGCTGAGTTCTTCCGACTGCTGG + Intergenic
1156872722 18:41966220-41966242 AGCTCAGATCACCCCACAGCAGG - Intronic
1157589705 18:48829014-48829036 AGCTCAGCTCTGCAGATAGCAGG - Intronic
1157657080 18:49400905-49400927 AGCTCAGATGTGCTGGCAGCAGG + Intronic
1157813148 18:50711954-50711976 GGCTCAGCTCAGCTGACAGCAGG + Intronic
1158292089 18:55954135-55954157 ATCTCAGATCTGCAGACAGCAGG + Intergenic
1163688247 19:18724540-18724562 AGCTCGGCCCTGCCGACACCTGG - Intronic
1163943361 19:20514859-20514881 ATCTCAGATCTGCAGACAGCAGG - Intergenic
1163966515 19:20751824-20751846 AGCTCAGATCTGCCGACAGCAGG - Intronic
1164173769 19:22749887-22749909 GGCTCAGCTCTGCTTACAGCAGG + Intergenic
1164480902 19:28610208-28610230 AGCTCAGATCTGCAGACAGCAGG + Intergenic
1167942458 19:52958657-52958679 AGCCCAGATCTGCTGACAGCAGG + Intronic
925290798 2:2747468-2747490 AGCTCAGCTCTTCCCAGAGCCGG + Intergenic
926864682 2:17344066-17344088 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
927438881 2:23095401-23095423 AGCTCAGATAAGCCAGCAGCTGG + Intergenic
928677308 2:33662279-33662301 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
929407800 2:41663036-41663058 AGCTTAGATCTACCTACAGTGGG + Intergenic
930518391 2:52434487-52434509 AGCTCAGAATTGCATACAGCAGG + Intergenic
931698531 2:64890251-64890273 AGCTCAGATCTGCCAACAGCAGG - Intergenic
932340648 2:70960926-70960948 CGCTCAGATCTGCCGCCAGGCGG + Exonic
932349778 2:71022566-71022588 AGCTCAGATCTGCCGACAGCAGG + Intergenic
932353284 2:71048693-71048715 AGCTCAGATCTGCTGATAGCAGG + Intergenic
932917891 2:75876876-75876898 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
934671929 2:96219657-96219679 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
935748901 2:106213156-106213178 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
936283324 2:111161482-111161504 AGGCCAGCTCTGCAGACAGCAGG + Intronic
936468633 2:112777009-112777031 AGATGAGAGCTGCCGACAGGAGG - Intronic
937064147 2:119004611-119004633 AGCTCACTTGTGCCCACAGCTGG - Intergenic
937989721 2:127655376-127655398 AGCTCAGGGCTGCGGCCAGCAGG + Intronic
938766771 2:134464878-134464900 AGCTCAGCTCTGCACCCAGCAGG + Intronic
938805921 2:134807186-134807208 AGCCCAGCTTTGCCTACAGCAGG - Intergenic
939493445 2:142902630-142902652 GGCTCAGCTCTGCTTACAGCAGG - Intronic
940869366 2:158847346-158847368 AGCTCAGATCTGCTGACAGCAGG + Intronic
940872038 2:158868341-158868363 AGCTCAGATCTGCCGACAGCAGG + Intergenic
940874256 2:158884345-158884367 AGCTCAGATCTGCCGACAGCAGG + Intergenic
943309608 2:186310008-186310030 AGCTGACATCTGCCCACAGAGGG + Intergenic
946396571 2:219446352-219446374 AGCTCAGAGCTGCCGGCAAGAGG + Intronic
946580623 2:221124779-221124801 AGCTCAGGGCTCCCAACAGCTGG - Intergenic
947535629 2:230939160-230939182 AGCTCAGCTTTGCCCCCAGCAGG + Intronic
947594840 2:231404493-231404515 AGCTCAGATCTGCCGACCGCAGG + Intergenic
947817076 2:233044719-233044741 ATCTCAGCTGTGCAGACAGCGGG - Intergenic
948674782 2:239590463-239590485 AGCCCAGACCTGCCCACTGCAGG - Intergenic
1168741184 20:192873-192895 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1169941173 20:10938878-10938900 AGCTCAGATCTGCAGAATGAAGG - Intergenic
1171408400 20:24929210-24929232 AGCTCAGATCTGCCGACAGCAGG + Intergenic
1174339075 20:49884730-49884752 ACCTCAGCTCTCCCTACAGCTGG - Intronic
1174977324 20:55350031-55350053 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1176244631 20:64091556-64091578 AGCTTTGATCTGTCGAGAGCTGG + Intronic
1176696944 21:9989583-9989605 AGCTCAGATTTTCTGAAAGCTGG + Intergenic
1177263302 21:18755363-18755385 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1178641470 21:34348075-34348097 AGCTCAGATTTGGCGCCACCTGG + Intergenic
1179258920 21:39741448-39741470 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1179308866 21:40179377-40179399 AGCACAGATCAGCCGACTGGGGG + Intronic
1180868788 22:19134515-19134537 GGCTGAGAGCTGCCGGCAGCAGG + Intronic
1182347717 22:29678342-29678364 AGTTCACAGCTGCCCACAGCAGG - Intronic
949157960 3:850093-850115 AGCTCAGATCTGCAGACAGCAGG + Intergenic
949345444 3:3072176-3072198 AGTGCAGAGCTGCCTACAGCTGG - Intronic
949882893 3:8675522-8675544 AGCTCAGATCTGCCGACAGCAGG + Intronic
949883249 3:8677241-8677263 ATCTCAGAGCTGCCGAAGGCAGG + Intronic
949884389 3:8681926-8681948 AGCTCAGAGCTGCCGAAAGCAGG + Intronic
950088826 3:10280361-10280383 AGCTCTGCTCTGCCGCCTGCTGG + Exonic
951166150 3:19486918-19486940 AGCTCAGATCTGCAGACAGCAGG - Intronic
951838128 3:27004396-27004418 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
952922010 3:38292030-38292052 GGCTCAGCTCTGCTCACAGCAGG - Intronic
953217131 3:40930233-40930255 AGCTGACATCTGCCCACAGAGGG + Intergenic
953610357 3:44442774-44442796 AGCTCAGAACCACCCACAGCCGG + Exonic
955798511 3:62662349-62662371 AGCCCAGATCAGACGAGAGCTGG - Exonic
957000066 3:74875006-74875028 AGCTCAGCTCTGCTCACAGTAGG - Intergenic
957044553 3:75363750-75363772 AGCTCAGATTTGCCGACAGCAGG - Intergenic
957076345 3:75605937-75605959 AGCTCAGATCTGCCGACAGCAGG - Intergenic
957406126 3:79776559-79776581 AGCTCAGATCTGCAGACAGCAGG + Intergenic
958016032 3:87941410-87941432 GGCTCAGCTCTGCTTACAGCAGG - Intergenic
960300910 3:116001577-116001599 AGCTCAGCTCTGCTGACATTTGG - Intronic
961272098 3:125697011-125697033 AGCTCAGATCTGCCAACAGCAGG + Intergenic
961274958 3:125719244-125719266 AGCTCAGATCTGCCGACGGCAGG + Intergenic
961277874 3:125741875-125741897 AGCTCAGATCTGCCGATGGCAGG + Intergenic
961876546 3:130027787-130027809 AGCTCAGATCTGCTGATGGCAGG - Intergenic
961892988 3:130145939-130145961 AGCTTAGATCTGCTGACAGCAGG - Intergenic
962495669 3:135936711-135936733 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
963809269 3:149758642-149758664 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
963915983 3:150859144-150859166 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
964522553 3:157584242-157584264 AGCTCACGTCTGCAGACAGCAGG - Intronic
964953639 3:162326169-162326191 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
966353723 3:179057650-179057672 GGCTCAGCTCTGCTCACAGCAGG + Intronic
967623768 3:191663391-191663413 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
968725651 4:2246673-2246695 ACCTCTGATCTGCCGAGGGCCGG - Intergenic
968988815 4:3894991-3895013 AGCCCAGATCTGCCCACAGCAGG - Intergenic
969019795 4:4132231-4132253 AGCTCAGATCTGCCGACAGCAGG - Intergenic
969024502 4:4162634-4162656 AGCTCAGATCTGCCGACAGCAGG - Intergenic
969526190 4:7705290-7705312 AGCTCAGCCCTGCCGACCCCTGG + Intronic
969528388 4:7715785-7715807 AGCTGAGACCTGCAGGCAGCAGG - Intronic
969645176 4:8424032-8424054 GGCTCAGCTCTGCTCACAGCAGG + Intronic
969729319 4:8944529-8944551 AGCTCAGATCTGCCGACAGCAGG + Intergenic
969734063 4:8975182-8975204 AGCTCAGATCTGCCGACAGCAGG + Intergenic
969749775 4:9101202-9101224 AGCTCAGATCTGCTGACAGCAGG + Intergenic
969793642 4:9509239-9509261 AGCTCAGATCTGCCGACAGCAGG + Intergenic
969826544 4:9762603-9762625 AGCTCAGATCTGCCGACAGCAGG + Intergenic
972781146 4:42287985-42288007 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
976970162 4:91094029-91094051 AGCTCAGATCTGCAGACAGCAGG - Intronic
977401157 4:96534307-96534329 AGCTGAGACCTGCCAAGAGCTGG + Intergenic
977834679 4:101634049-101634071 GGCTCAGCTATGCCTACAGCAGG - Intronic
978909778 4:114049626-114049648 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
980779996 4:137482027-137482049 AGCTCAGATCTGCAGACAGCAGG + Intergenic
980872582 4:138626670-138626692 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
981604845 4:146529636-146529658 AGCTCAGATCTGCCAACAGCAGG + Intergenic
983666810 4:170192387-170192409 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
984723954 4:183002207-183002229 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
985010897 4:185580967-185580989 GGCTCAGATCAGCCCAGAGCAGG - Intergenic
985063603 4:186101568-186101590 AACTCAAATGTGCCCACAGCTGG + Intergenic
986134972 5:4968340-4968362 AGCTCAGTTCTGCCCAGAGAAGG + Intergenic
988795998 5:34654344-34654366 AGCTAAGTTCTGCCAACTGCAGG - Intergenic
989039473 5:37212252-37212274 AGCTCTTATCTGCCGACTCCTGG - Intronic
990048874 5:51469993-51470015 GGCTCTGATCTGCCAACAGTGGG - Intergenic
990892501 5:60663832-60663854 GGCTCAGCTCTGCTTACAGCAGG + Intronic
992791923 5:80221236-80221258 ATCTGACATCAGCCGACAGCAGG + Intronic
993320338 5:86462333-86462355 AGCTCAGATCTGCAGACAGTAGG + Intergenic
993328291 5:86568031-86568053 AGCTCAGATCTGCAGATAGCAGG - Intergenic
995473686 5:112527626-112527648 AGCTCAGATCTGCAGACAGCAGG + Intergenic
995753516 5:115477626-115477648 AGCTTAGATCTGCGGAGAGTGGG + Intergenic
997657146 5:135563929-135563951 AGGACAGCTCTGCAGACAGCTGG + Intergenic
997835052 5:137185372-137185394 AGCTCAGCTCTGGTGACAGGTGG - Intronic
1000287532 5:159839529-159839551 AGCTCAGATATGACGAGAGCAGG - Intergenic
1002408316 5:179053683-179053705 AGCTCAGATCTGCAGACAGCAGG - Intergenic
1002916893 6:1536698-1536720 ACCTCACAGCAGCCGACAGCCGG + Intergenic
1003008814 6:2407422-2407444 AGCTCATTTCTCCCCACAGCTGG - Intergenic
1003562734 6:7196158-7196180 AGCCCAGATCTGCCTCAAGCAGG - Intronic
1003651173 6:7961646-7961668 AGGTCAGAGCTGCCAACAGGAGG - Intronic
1005323449 6:24677919-24677941 TGCTCAGCTCTGCTCACAGCAGG - Intronic
1005429415 6:25739174-25739196 AGATCAGATCTGCCAGCACCCGG - Intergenic
1006993918 6:38240064-38240086 AGCTCAGATCTTCCCAGAGATGG - Intronic
1008582107 6:52916850-52916872 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1010893675 6:81341999-81342021 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1011076997 6:83448205-83448227 GGCTCAGCTCTGCTTACAGCAGG + Intergenic
1011539640 6:88416359-88416381 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1011565208 6:88665910-88665932 AGCTCAGATCTGCAGACAGCAGG + Intronic
1013022457 6:106233154-106233176 GGCTCAGCTCTGCTCACAGCAGG + Intronic
1013411190 6:109885385-109885407 AGCTCAAATTTGCCAACAGAAGG + Intergenic
1013411937 6:109890651-109890673 AGCTCAAATTTGCCAACAGAAGG - Intergenic
1015865270 6:137721118-137721140 GGCTCAGCTCTGCTTACAGCAGG - Intergenic
1016343031 6:143083142-143083164 GGCTCAGCTCTGCTTACAGCAGG - Intronic
1016444494 6:144118503-144118525 GGCTCAGATCTGCTCACAGCAGG - Intergenic
1017262347 6:152401996-152402018 ACCTCAGATCTGCTGGGAGCAGG + Intronic
1017853255 6:158324800-158324822 ATCTCAGATCTGCCATCATCTGG - Intronic
1018762558 6:166904519-166904541 AGCTCAGAAGTGCTGACAGCAGG + Intronic
1020307195 7:6844268-6844290 AGCTCAGATCTGCCGACAGCAGG - Intergenic
1020311671 7:6873105-6873127 AGCTCAGATCTGCCGACAGCAGG - Intergenic
1020323216 7:6955439-6955461 AGCTCAGATCTGCCGACAGCAGG - Intergenic
1021593009 7:22285046-22285068 CGCTCACATCAGCCTACAGCTGG + Intronic
1023149171 7:37183612-37183634 AGCACAGATGTGCTCACAGCAGG + Intronic
1028484414 7:91342391-91342413 AGGTCTCATCTGCCAACAGCTGG + Intergenic
1029078333 7:97953205-97953227 AGCTCAGATCTGCCTACAGCAGG - Intergenic
1034288002 7:149903196-149903218 TGATCAGAACTGCAGACAGCAGG - Intergenic
1034303121 7:150033453-150033475 AGTTCAAATCTTCCGACGGCAGG - Intergenic
1034303427 7:150034673-150034695 AGTTCAAATCTTCCGACGGCAGG - Intergenic
1034303545 7:150035061-150035083 AGTTCAAATCTTCCGACGGCAGG - Intergenic
1034303712 7:150035609-150035631 AGTTCAAATCTTCCGACGGCAGG - Intergenic
1034304257 7:150037618-150037640 AGTTCAAATCTTCCGACGGCAGG - Intergenic
1034304627 7:150039047-150039069 AGTTCAAATCTTCCGACAGCAGG - Intergenic
1034304799 7:150039594-150039616 AGTTCAAATCTTCCGACGGCAGG - Intergenic
1034305057 7:150040658-150040680 AGCTCAAATCTTCCGACGGCAGG - Intergenic
1034305376 7:150041955-150041977 AGTTCAAATCTTCCGACAGCAGG - Intergenic
1034305689 7:150043182-150043204 AGCTCAAATCTTCCGACGGCAGG - Intergenic
1034663122 7:152789736-152789758 TGATCAGAACTGCAGACAGCAGG + Intronic
1034801155 7:154057468-154057490 AGCTCAAATCTTCCGACGGCAGG + Intronic
1034801469 7:154058696-154058718 AGTTCAAATCTTCCGACGGCAGG + Intronic
1034801691 7:154059406-154059428 AGATCAAATCTTCCGACGGCAGG + Intronic
1034801974 7:154060545-154060567 AGTTCAAATCTTCCGACGGCAGG + Intronic
1036239672 8:7071299-7071321 AGCTCAGATCTGCTGACAGCAGG + Intergenic
1036262205 8:7249852-7249874 AGCTCAGATCTGCCGACAGCAGG - Intergenic
1036304383 8:7589706-7589728 AGCTCAGATCTGCCGACAGCAGG + Intergenic
1036314244 8:7708391-7708413 AGCTCAGATCTGCCGACAGCAGG - Intergenic
1036355235 8:8037698-8037720 AGCTCAGATCTGCCGACAGCAGG + Intergenic
1036372853 8:8175544-8175566 AGCTCAGATCTGCCGACAGCAGG + Intergenic
1036691262 8:10946222-10946244 AGATCAGCTCTGCCCACAGGAGG + Intronic
1036816774 8:11908318-11908340 AGCTCAGATCTGCTGACAGCAGG - Intergenic
1036833496 8:12039850-12039872 AGCTCAGATCTGCTGACAGCAGG - Intergenic
1036855342 8:12286415-12286437 AGCTCAGATCTGCTGACAGCAGG - Intergenic
1036878052 8:12490097-12490119 AGCTCAGATCTGCCGACGGCAGG - Intergenic
1036903657 8:12690267-12690289 AGCTCAGAACTGCTGACAGCAGG - Intergenic
1036906143 8:12709900-12709922 AGCTCAGATCTGCCAACAGCAGG - Intergenic
1038798967 8:30732349-30732371 AGCTCAGATCTGCCAACAGCAGG + Intronic
1039278232 8:35955250-35955272 AGCTCAGATCTGCAGATAGCAGG + Intergenic
1040527528 8:48238115-48238137 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1040964823 8:53072860-53072882 GGCTCAGCTTTGCCTACAGCAGG - Intergenic
1041030787 8:53733544-53733566 AGCTCAGATCTGCAGACAGCAGG + Intronic
1041663650 8:60422470-60422492 GGCTCAGCTCTGCTTACAGCAGG - Intergenic
1043490187 8:80740988-80741010 GGCTCAGCTCTGCTTACAGCAGG + Intronic
1047993745 8:130313923-130313945 AGCTCAGCCCTGCAGACTGCTGG + Intronic
1048957515 8:139549168-139549190 AGCTCAGATCTGCTGACAGCAGG - Intergenic
1050277205 9:4012217-4012239 AGCTCAGATGTCTCTACAGCAGG + Intronic
1051528669 9:18075825-18075847 GGCACAGGTCTGCCCACAGCAGG - Intergenic
1053633927 9:39975420-39975442 AGCTCAGATTTTCTGAAAGCTGG + Intergenic
1053771819 9:41488084-41488106 AGCTCAGATTTTCTGAAAGCTGG - Intergenic
1054209960 9:62275277-62275299 AGCTCAGATTTTCTGAAAGCTGG - Intergenic
1054315033 9:63573677-63573699 AGCTCAGATTTTCTGAAAGCTGG + Intergenic
1054867762 9:70020275-70020297 AGCTCAGATATGCCCACCGCGGG - Intergenic
1056865676 9:90225800-90225822 AGCTCAGATCTGCCGACGGCAGG + Intergenic
1056917332 9:90757102-90757124 AGCTCAGATCTGCGGACGGCAGG - Intergenic
1057058290 9:91980809-91980831 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1058828772 9:108797176-108797198 AGCTCAGTTCTGCAGACTTCAGG + Intergenic
1060659270 9:125394132-125394154 TGCTCAGATGTGACGTCAGCTGG - Intergenic
1060725854 9:126005449-126005471 AGATCAGATCTGCCGGCAACAGG - Intergenic
1061912000 9:133729885-133729907 AGCTCAGCTCTGCTGACACCTGG + Intronic
1062056987 9:134473933-134473955 AGCCCAGGTCAGCTGACAGCAGG - Intergenic
1062292245 9:135801344-135801366 AGCACAGAGCTGCAGACTGCTGG - Intergenic
1062525944 9:136978206-136978228 GGCTCAGCTCTGCGGACCGCTGG - Intronic
1185478888 X:431347-431369 GCCTCACATCTGCCGACATCGGG + Intergenic
1185909813 X:3971149-3971171 AGCTCAGATCTGCAGACAGCAGG + Intergenic
1190056084 X:47181767-47181789 AGCTCAGATTTGAGCACAGCGGG - Exonic
1190315028 X:49145237-49145259 AGCTCAGATCTGCAGATAGCAGG - Intergenic
1190425992 X:50334973-50334995 AGCTCAGATCTGCAGACAGCAGG - Intronic
1191036172 X:56028460-56028482 AGCTCAGATTTGCAGACAGCAGG - Intergenic
1191214783 X:57922995-57923017 AGCCTAGATCTGCTGACAGCAGG + Intergenic
1191924984 X:66299262-66299284 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1192939751 X:75900456-75900478 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1193070076 X:77297574-77297596 GGCCCAGATCTGCAGACAGCAGG + Intergenic
1193306914 X:79960904-79960926 GGCTCAGCTCTGCTCACAGCAGG + Intergenic
1194400399 X:93433433-93433455 AGTTCAGATCTGCCGACAGCAGG + Intergenic
1194532826 X:95072052-95072074 AGCTCAGACCTTCCTCCAGCGGG - Intergenic
1195630974 X:107054744-107054766 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1196527132 X:116740134-116740156 GGCTCAGCTCTGCTCACAGCAGG - Intergenic
1198537486 X:137600897-137600919 AGTTCACATCTGCCCACAGAGGG + Intergenic
1198765753 X:140077850-140077872 AGCTCAGCTCTGCTCACAGCAGG + Intergenic
1198969933 X:142268915-142268937 AGCTCAGATCTGCAGACAGTAGG + Intergenic
1199979480 X:152913130-152913152 AGCTCAGCACTGCTGCCAGCTGG - Intergenic
1200394226 X:155973940-155973962 AGCTCAGATCTGCAGACAGCAGG - Intergenic
1200943254 Y:8806707-8806729 ATCTCAGATCTGCAGACAGCAGG + Intergenic
1200948076 Y:8865717-8865739 AGCTCAGATCTGCCAACAGCAGG + Intergenic
1200983734 Y:9285480-9285502 AGCTCAAATCTGAAGACAGCAGG - Intergenic
1201270224 Y:12246976-12246998 AGCTCAGACCTGCAGACAGCAGG + Intergenic
1201680643 Y:16641088-16641110 AGCTCAGACCTGCAGACAGCAGG - Intergenic
1201696817 Y:16835227-16835249 AGCTCAGATCTGCAGACAGCAGG + Intergenic
1202037163 Y:20646957-20646979 AGCTCAGCTCTCCAGACAGCAGG + Intergenic
1202126634 Y:21574222-21574244 AGCTCAAATCTGAAGACAGCAGG + Intergenic