ID: 1036355237

View in Genome Browser
Species Human (GRCh38)
Location 8:8037710-8037732
Sequence CCGACAGCAGGTACGTTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036355234_1036355237 -1 Left 1036355234 8:8037688-8037710 CCAAGAAGAAAGCTCAGATCTGC 0: 69
1: 55
2: 26
3: 35
4: 431
Right 1036355237 8:8037710-8037732 CCGACAGCAGGTACGTTACTTGG No data
1036355232_1036355237 25 Left 1036355232 8:8037662-8037684 CCTGGAGGACTGTGGGTAGAAGG No data
Right 1036355237 8:8037710-8037732 CCGACAGCAGGTACGTTACTTGG No data
1036355231_1036355237 30 Left 1036355231 8:8037657-8037679 CCGCACCTGGAGGACTGTGGGTA No data
Right 1036355237 8:8037710-8037732 CCGACAGCAGGTACGTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036355237 Original CRISPR CCGACAGCAGGTACGTTACT TGG Intergenic
No off target data available for this crispr