ID: 1036355400

View in Genome Browser
Species Human (GRCh38)
Location 8:8038733-8038755
Sequence AAGGGCCTATTGAATTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036355394_1036355400 8 Left 1036355394 8:8038702-8038724 CCTTCAAGTGCATGGAGTGTGAT No data
Right 1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG No data
1036355393_1036355400 9 Left 1036355393 8:8038701-8038723 CCCTTCAAGTGCATGGAGTGTGA No data
Right 1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036355400 Original CRISPR AAGGGCCTATTGAATTCTGG GGG Intergenic
No off target data available for this crispr