ID: 1036358411

View in Genome Browser
Species Human (GRCh38)
Location 8:8060993-8061015
Sequence TAGCATGACCTGAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036358402_1036358411 15 Left 1036358402 8:8060955-8060977 CCCCACTGAATTGTTTGGTCCAC No data
Right 1036358411 8:8060993-8061015 TAGCATGACCTGAAGGATGATGG No data
1036358403_1036358411 14 Left 1036358403 8:8060956-8060978 CCCACTGAATTGTTTGGTCCACA No data
Right 1036358411 8:8060993-8061015 TAGCATGACCTGAAGGATGATGG No data
1036358409_1036358411 -4 Left 1036358409 8:8060974-8060996 CCACAGAGGGAAATGGGAATAGC No data
Right 1036358411 8:8060993-8061015 TAGCATGACCTGAAGGATGATGG No data
1036358404_1036358411 13 Left 1036358404 8:8060957-8060979 CCACTGAATTGTTTGGTCCACAG No data
Right 1036358411 8:8060993-8061015 TAGCATGACCTGAAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036358411 Original CRISPR TAGCATGACCTGAAGGATGA TGG Intergenic
No off target data available for this crispr