ID: 1036358540

View in Genome Browser
Species Human (GRCh38)
Location 8:8061845-8061867
Sequence GCTGTGGGTCAGACACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036358540_1036358548 17 Left 1036358540 8:8061845-8061867 CCAGGGTGTGTCTGACCCACAGC No data
Right 1036358548 8:8061885-8061907 AAAAGTCTCTCCTAGGTATTTGG No data
1036358540_1036358543 -10 Left 1036358540 8:8061845-8061867 CCAGGGTGTGTCTGACCCACAGC No data
Right 1036358543 8:8061858-8061880 GACCCACAGCTCCTCATGGAGGG No data
1036358540_1036358547 10 Left 1036358540 8:8061845-8061867 CCAGGGTGTGTCTGACCCACAGC No data
Right 1036358547 8:8061878-8061900 GGGAGAGAAAAGTCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036358540 Original CRISPR GCTGTGGGTCAGACACACCC TGG (reversed) Intergenic
No off target data available for this crispr