ID: 1036359411

View in Genome Browser
Species Human (GRCh38)
Location 8:8066454-8066476
Sequence ACGTTGGCCCCTGAATCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036359403_1036359411 15 Left 1036359403 8:8066416-8066438 CCGGGGCGCTGTCCCTGTGAGCT No data
Right 1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG No data
1036359405_1036359411 3 Left 1036359405 8:8066428-8066450 CCCTGTGAGCTCCTGGTGTCCTG No data
Right 1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG No data
1036359406_1036359411 2 Left 1036359406 8:8066429-8066451 CCTGTGAGCTCCTGGTGTCCTGC No data
Right 1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG No data
1036359401_1036359411 17 Left 1036359401 8:8066414-8066436 CCCCGGGGCGCTGTCCCTGTGAG No data
Right 1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG No data
1036359408_1036359411 -8 Left 1036359408 8:8066439-8066461 CCTGGTGTCCTGCAAACGTTGGC No data
Right 1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG No data
1036359402_1036359411 16 Left 1036359402 8:8066415-8066437 CCCGGGGCGCTGTCCCTGTGAGC No data
Right 1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG No data
1036359400_1036359411 25 Left 1036359400 8:8066406-8066428 CCTTGCATCCCCGGGGCGCTGTC No data
Right 1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036359411 Original CRISPR ACGTTGGCCCCTGAATCACC GGG Intergenic
No off target data available for this crispr