ID: 1036363678

View in Genome Browser
Species Human (GRCh38)
Location 8:8099402-8099424
Sequence CTGTGTTTAAGGTGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036363670_1036363678 12 Left 1036363670 8:8099367-8099389 CCCCCAGGTTTGGAAGGATGGGA No data
Right 1036363678 8:8099402-8099424 CTGTGTTTAAGGTGAGAAGTGGG No data
1036363672_1036363678 10 Left 1036363672 8:8099369-8099391 CCCAGGTTTGGAAGGATGGGAAG No data
Right 1036363678 8:8099402-8099424 CTGTGTTTAAGGTGAGAAGTGGG No data
1036363673_1036363678 9 Left 1036363673 8:8099370-8099392 CCAGGTTTGGAAGGATGGGAAGG No data
Right 1036363678 8:8099402-8099424 CTGTGTTTAAGGTGAGAAGTGGG No data
1036363671_1036363678 11 Left 1036363671 8:8099368-8099390 CCCCAGGTTTGGAAGGATGGGAA No data
Right 1036363678 8:8099402-8099424 CTGTGTTTAAGGTGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036363678 Original CRISPR CTGTGTTTAAGGTGAGAAGT GGG Intergenic
No off target data available for this crispr