ID: 1036370910

View in Genome Browser
Species Human (GRCh38)
Location 8:8162276-8162298
Sequence AAAGAGAGATTATTCAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036370910_1036370917 6 Left 1036370910 8:8162276-8162298 CCCACCCTGAATAATCTCTCTTT No data
Right 1036370917 8:8162305-8162327 ACTCAAAGTGAATGGATTAGGGG No data
1036370910_1036370914 -2 Left 1036370910 8:8162276-8162298 CCCACCCTGAATAATCTCTCTTT No data
Right 1036370914 8:8162297-8162319 TTTGATTAACTCAAAGTGAATGG No data
1036370910_1036370916 5 Left 1036370910 8:8162276-8162298 CCCACCCTGAATAATCTCTCTTT No data
Right 1036370916 8:8162304-8162326 AACTCAAAGTGAATGGATTAGGG No data
1036370910_1036370915 4 Left 1036370910 8:8162276-8162298 CCCACCCTGAATAATCTCTCTTT No data
Right 1036370915 8:8162303-8162325 TAACTCAAAGTGAATGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036370910 Original CRISPR AAAGAGAGATTATTCAGGGT GGG (reversed) Intergenic
No off target data available for this crispr