ID: 1036372999

View in Genome Browser
Species Human (GRCh38)
Location 8:8176578-8176600
Sequence AAGGGCTTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036372993_1036372999 8 Left 1036372993 8:8176547-8176569 CCTTCAAATGCATGGAACATTAT No data
Right 1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG No data
1036372992_1036372999 9 Left 1036372992 8:8176546-8176568 CCCTTCAAATGCATGGAACATTA No data
Right 1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG No data
1036372990_1036372999 18 Left 1036372990 8:8176537-8176559 CCTTTTCAACCCTTCAAATGCAT No data
Right 1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036372999 Original CRISPR AAGGGCTTATTGAACTCTGG GGG Intergenic
No off target data available for this crispr