ID: 1036374561

View in Genome Browser
Species Human (GRCh38)
Location 8:8189306-8189328
Sequence CCTCCTGGTGTTATTCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036374557_1036374561 -9 Left 1036374557 8:8189292-8189314 CCTTAATATTCCCACCTCCTGGT No data
Right 1036374561 8:8189306-8189328 CCTCCTGGTGTTATTCACTGTGG No data
1036374555_1036374561 4 Left 1036374555 8:8189279-8189301 CCTTCACAATGGACCTTAATATT No data
Right 1036374561 8:8189306-8189328 CCTCCTGGTGTTATTCACTGTGG No data
1036374554_1036374561 8 Left 1036374554 8:8189275-8189297 CCATCCTTCACAATGGACCTTAA No data
Right 1036374561 8:8189306-8189328 CCTCCTGGTGTTATTCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036374561 Original CRISPR CCTCCTGGTGTTATTCACTG TGG Intergenic
No off target data available for this crispr