ID: 1036380292

View in Genome Browser
Species Human (GRCh38)
Location 8:8232251-8232273
Sequence CACTTGGAAAGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036380292_1036380305 26 Left 1036380292 8:8232251-8232273 CCCTCTGCCCTCCTTTCCAAGTG No data
Right 1036380305 8:8232300-8232322 CACAGGCTGTTCCCACTGCCTGG 0: 7
1: 20
2: 127
3: 529
4: 1395
1036380292_1036380302 9 Left 1036380292 8:8232251-8232273 CCCTCTGCCCTCCTTTCCAAGTG No data
Right 1036380302 8:8232283-8232305 GGCCACCTCAGAGCTTGCACAGG 0: 6
1: 1
2: 2
3: 17
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036380292 Original CRISPR CACTTGGAAAGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr