ID: 1036381945

View in Genome Browser
Species Human (GRCh38)
Location 8:8241348-8241370
Sequence TTTCTTTAAAGAGGCACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036381945_1036381949 24 Left 1036381945 8:8241348-8241370 CCAGAGGTGCCTCTTTAAAGAAA No data
Right 1036381949 8:8241395-8241417 ACAGCCCTGCAATGAAATCATGG No data
1036381945_1036381947 -1 Left 1036381945 8:8241348-8241370 CCAGAGGTGCCTCTTTAAAGAAA No data
Right 1036381947 8:8241370-8241392 AGATGCCAGCTTGTCGTAGACGG 0: 1
1: 1
2: 8
3: 3
4: 86
1036381945_1036381951 28 Left 1036381945 8:8241348-8241370 CCAGAGGTGCCTCTTTAAAGAAA No data
Right 1036381951 8:8241399-8241421 CCCTGCAATGAAATCATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036381945 Original CRISPR TTTCTTTAAAGAGGCACCTC TGG (reversed) Intergenic
No off target data available for this crispr