ID: 1036382638

View in Genome Browser
Species Human (GRCh38)
Location 8:8247412-8247434
Sequence AAATCCTGCTTCACAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036382638_1036382641 27 Left 1036382638 8:8247412-8247434 CCTGTCTTTGTGAAGCAGGATTT No data
Right 1036382641 8:8247462-8247484 TTATGTAGACTGGACATAAGCGG No data
1036382638_1036382640 17 Left 1036382638 8:8247412-8247434 CCTGTCTTTGTGAAGCAGGATTT No data
Right 1036382640 8:8247452-8247474 CAAAATGAGATTATGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036382638 Original CRISPR AAATCCTGCTTCACAAAGAC AGG (reversed) Intergenic