ID: 1036382638 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:8247412-8247434 |
Sequence | AAATCCTGCTTCACAAAGAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1036382638_1036382641 | 27 | Left | 1036382638 | 8:8247412-8247434 | CCTGTCTTTGTGAAGCAGGATTT | No data | ||
Right | 1036382641 | 8:8247462-8247484 | TTATGTAGACTGGACATAAGCGG | No data | ||||
1036382638_1036382640 | 17 | Left | 1036382638 | 8:8247412-8247434 | CCTGTCTTTGTGAAGCAGGATTT | No data | ||
Right | 1036382640 | 8:8247452-8247474 | CAAAATGAGATTATGTAGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1036382638 | Original CRISPR | AAATCCTGCTTCACAAAGAC AGG (reversed) | Intergenic | ||