ID: 1036382920

View in Genome Browser
Species Human (GRCh38)
Location 8:8250380-8250402
Sequence CCTCAAATTCAGTGCCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036382920_1036382924 18 Left 1036382920 8:8250380-8250402 CCTTCTAGGCACTGAATTTGAGG No data
Right 1036382924 8:8250421-8250443 CATGGATATTAACATCTAGCTGG No data
1036382920_1036382922 0 Left 1036382920 8:8250380-8250402 CCTTCTAGGCACTGAATTTGAGG No data
Right 1036382922 8:8250403-8250425 CTAAATGTTATTTCCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036382920 Original CRISPR CCTCAAATTCAGTGCCTAGA AGG (reversed) Intergenic
No off target data available for this crispr