ID: 1036383059

View in Genome Browser
Species Human (GRCh38)
Location 8:8251717-8251739
Sequence ACATTCCCACACAAAGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036383059_1036383064 28 Left 1036383059 8:8251717-8251739 CCTTATTCTTTGTGTGGGAATGT No data
Right 1036383064 8:8251768-8251790 AATTTTTACTATCTGATATATGG No data
1036383059_1036383061 5 Left 1036383059 8:8251717-8251739 CCTTATTCTTTGTGTGGGAATGT No data
Right 1036383061 8:8251745-8251767 CCACTTCCTCAATGCCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036383059 Original CRISPR ACATTCCCACACAAAGAATA AGG (reversed) Intergenic
No off target data available for this crispr