ID: 1036384960

View in Genome Browser
Species Human (GRCh38)
Location 8:8270779-8270801
Sequence ATTCCCATAGGGGATAGAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036384960_1036384967 10 Left 1036384960 8:8270779-8270801 CCGATTCTATCCCCTATGGGAAT No data
Right 1036384967 8:8270812-8270834 CATTACCTACTTAACACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036384960 Original CRISPR ATTCCCATAGGGGATAGAAT CGG (reversed) Intergenic
No off target data available for this crispr