ID: 1036388727

View in Genome Browser
Species Human (GRCh38)
Location 8:8306217-8306239
Sequence AGTTGGCAGGGTCCAGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036388727_1036388733 -3 Left 1036388727 8:8306217-8306239 CCAAGGTCTGGACCCTGCCAACT No data
Right 1036388733 8:8306237-8306259 ACTGTAGCTGTCAGGGACCCCGG No data
1036388727_1036388738 20 Left 1036388727 8:8306217-8306239 CCAAGGTCTGGACCCTGCCAACT No data
Right 1036388738 8:8306260-8306282 AGTAGGTTCCATAAGTTCTCAGG No data
1036388727_1036388734 3 Left 1036388727 8:8306217-8306239 CCAAGGTCTGGACCCTGCCAACT No data
Right 1036388734 8:8306243-8306265 GCTGTCAGGGACCCCGGAGTAGG No data
1036388727_1036388731 -10 Left 1036388727 8:8306217-8306239 CCAAGGTCTGGACCCTGCCAACT No data
Right 1036388731 8:8306230-8306252 CCTGCCAACTGTAGCTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036388727 Original CRISPR AGTTGGCAGGGTCCAGACCT TGG (reversed) Intergenic