ID: 1036388728

View in Genome Browser
Species Human (GRCh38)
Location 8:8306229-8306251
Sequence CCTGACAGCTACAGTTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036388728_1036388740 19 Left 1036388728 8:8306229-8306251 CCCTGCCAACTGTAGCTGTCAGG No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data
1036388728_1036388738 8 Left 1036388728 8:8306229-8306251 CCCTGCCAACTGTAGCTGTCAGG No data
Right 1036388738 8:8306260-8306282 AGTAGGTTCCATAAGTTCTCAGG No data
1036388728_1036388734 -9 Left 1036388728 8:8306229-8306251 CCCTGCCAACTGTAGCTGTCAGG No data
Right 1036388734 8:8306243-8306265 GCTGTCAGGGACCCCGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036388728 Original CRISPR CCTGACAGCTACAGTTGGCA GGG (reversed) Intergenic