ID: 1036388730

View in Genome Browser
Species Human (GRCh38)
Location 8:8306230-8306252
Sequence CCCTGACAGCTACAGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036388730_1036388738 7 Left 1036388730 8:8306230-8306252 CCTGCCAACTGTAGCTGTCAGGG No data
Right 1036388738 8:8306260-8306282 AGTAGGTTCCATAAGTTCTCAGG No data
1036388730_1036388740 18 Left 1036388730 8:8306230-8306252 CCTGCCAACTGTAGCTGTCAGGG No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data
1036388730_1036388734 -10 Left 1036388730 8:8306230-8306252 CCTGCCAACTGTAGCTGTCAGGG No data
Right 1036388734 8:8306243-8306265 GCTGTCAGGGACCCCGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036388730 Original CRISPR CCCTGACAGCTACAGTTGGC AGG (reversed) Intergenic