ID: 1036388732

View in Genome Browser
Species Human (GRCh38)
Location 8:8306234-8306256
Sequence GGGTCCCTGACAGCTACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036388732_1036388740 14 Left 1036388732 8:8306234-8306256 CCAACTGTAGCTGTCAGGGACCC No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data
1036388732_1036388738 3 Left 1036388732 8:8306234-8306256 CCAACTGTAGCTGTCAGGGACCC No data
Right 1036388738 8:8306260-8306282 AGTAGGTTCCATAAGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036388732 Original CRISPR GGGTCCCTGACAGCTACAGT TGG (reversed) Intergenic
No off target data available for this crispr