ID: 1036388738

View in Genome Browser
Species Human (GRCh38)
Location 8:8306260-8306282
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036388727_1036388738 20 Left 1036388727 8:8306217-8306239 CCAAGGTCTGGACCCTGCCAACT No data
Right 1036388738 8:8306260-8306282 AGTAGGTTCCATAAGTTCTCAGG No data
1036388730_1036388738 7 Left 1036388730 8:8306230-8306252 CCTGCCAACTGTAGCTGTCAGGG No data
Right 1036388738 8:8306260-8306282 AGTAGGTTCCATAAGTTCTCAGG No data
1036388728_1036388738 8 Left 1036388728 8:8306229-8306251 CCCTGCCAACTGTAGCTGTCAGG No data
Right 1036388738 8:8306260-8306282 AGTAGGTTCCATAAGTTCTCAGG No data
1036388732_1036388738 3 Left 1036388732 8:8306234-8306256 CCAACTGTAGCTGTCAGGGACCC No data
Right 1036388738 8:8306260-8306282 AGTAGGTTCCATAAGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036388738 Original CRISPR AGTAGGTTCCATAAGTTCTC AGG Intergenic