ID: 1036388740

View in Genome Browser
Species Human (GRCh38)
Location 8:8306271-8306293
Sequence TAAGTTCTCAGGAATTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036388737_1036388740 -8 Left 1036388737 8:8306256-8306278 CCGGAGTAGGTTCCATAAGTTCT No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data
1036388730_1036388740 18 Left 1036388730 8:8306230-8306252 CCTGCCAACTGTAGCTGTCAGGG No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data
1036388732_1036388740 14 Left 1036388732 8:8306234-8306256 CCAACTGTAGCTGTCAGGGACCC No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data
1036388735_1036388740 -6 Left 1036388735 8:8306254-8306276 CCCCGGAGTAGGTTCCATAAGTT No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data
1036388728_1036388740 19 Left 1036388728 8:8306229-8306251 CCCTGCCAACTGTAGCTGTCAGG No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data
1036388736_1036388740 -7 Left 1036388736 8:8306255-8306277 CCCGGAGTAGGTTCCATAAGTTC No data
Right 1036388740 8:8306271-8306293 TAAGTTCTCAGGAATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036388740 Original CRISPR TAAGTTCTCAGGAATTATTT TGG Intergenic