ID: 1036389212

View in Genome Browser
Species Human (GRCh38)
Location 8:8310116-8310138
Sequence CTCATAAAACGGCTTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036389212_1036389216 8 Left 1036389212 8:8310116-8310138 CCAGTGAAAAGCCGTTTTATGAG No data
Right 1036389216 8:8310147-8310169 TGACAGGTGTTGTTTAGAAATGG No data
1036389212_1036389214 -8 Left 1036389212 8:8310116-8310138 CCAGTGAAAAGCCGTTTTATGAG No data
Right 1036389214 8:8310131-8310153 TTTATGAGAGCACCTGTGACAGG No data
1036389212_1036389217 17 Left 1036389212 8:8310116-8310138 CCAGTGAAAAGCCGTTTTATGAG No data
Right 1036389217 8:8310156-8310178 TTGTTTAGAAATGGTTATCTTGG No data
1036389212_1036389220 28 Left 1036389212 8:8310116-8310138 CCAGTGAAAAGCCGTTTTATGAG No data
Right 1036389220 8:8310167-8310189 TGGTTATCTTGGGCTGGATGTGG No data
1036389212_1036389218 18 Left 1036389212 8:8310116-8310138 CCAGTGAAAAGCCGTTTTATGAG No data
Right 1036389218 8:8310157-8310179 TGTTTAGAAATGGTTATCTTGGG No data
1036389212_1036389219 22 Left 1036389212 8:8310116-8310138 CCAGTGAAAAGCCGTTTTATGAG No data
Right 1036389219 8:8310161-8310183 TAGAAATGGTTATCTTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036389212 Original CRISPR CTCATAAAACGGCTTTTCAC TGG (reversed) Intergenic
No off target data available for this crispr